콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU066851

Sigma-Aldrich

MISSION® esiRNA

targeting human PYCARD

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTTGGACCTCACCGACAAGCTGGTCAGCTTCTACCTGGAGACCTACGGCGCCGAGCTCACCGCTAACGTGCTGCGCGACATGGGCCTGCAGGAGATGGCCGGGCAGCTGCAGGCGGCCACGCACCAGGGCCTGCACTTTATAGACCAGCACCGGGCTGCGCTTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGACGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGCTCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAAGGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGAGGCTCCTTCCCAGCAACACTCCGGTCAGC

Ensembl | 인체 수납 번호

ENSG00000103490

NCBI 수납 번호

NM_013258

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PYCARD(29108) , PYCARD(29108)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
RFT
JQS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lanny Gov et al.
mBio, 4(4) (2013-07-11)
Interleukin-1β (IL-1β) functions as a key regulator of inflammation and innate immunity. The protozoan parasite Toxoplasma gondii actively infects human blood monocytes and induces the production of IL-1β; however, the host and parasite factors that mediate IL-1β production during T.
Mairaj Ahmed Ansari et al.
PLoS pathogens, 11(7), e1005019-e1005019 (2015-07-03)
The IL-1β and type I interferon-β (IFN-β) molecules are important inflammatory cytokines elicited by the eukaryotic host as innate immune responses against invading pathogens and danger signals. Recently, a predominantly nuclear gamma-interferon-inducible protein 16 (IFI16) involved in transcriptional regulation has
Minda Zhang et al.
Journal of cellular physiology, 234(11), 20161-20173 (2019-04-07)
The human absent in melanoma 2 (AIM2) is considered as a DNA recognizer. AIM2 has been described as a tumor suppressor gene in the early years. But recent studies suggested that it functions as an oncogene in several cancers. However
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Fushan Shi et al.
Journal of neuroinflammation, 9, 73-73 (2012-04-26)
Prion diseases are neurodegenerative disorders characterized by the accumulation of an abnormal disease-associated prion protein, PrPSc. In prion-infected brains, activated microglia are often present in the vicinity of PrPSc aggregates, and microglial activation is thought to play a key role

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.