콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU063661

Sigma-Aldrich

MISSION® esiRNA

targeting human METTL3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAGCCAGCCAAGAAATCAAGGAAACATGCTGCCTCAGATGTTGATCTGGAGATAGAGAGCCTTCTGAACCAACAGTCCACTAAGGAACAACAGAGCAAGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACTACAACAGCCAAGGAACAATCCATTGTTGAAAAATTTCGCTCTCGAGGTCGGGCCCAAGTGCAAGAATTCTGTGACTATGGAACCAAGGAGGAGTGCATGAAAGCCAGTGATGCTGATCGACCCTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAACACACTGATGAGTCTTTAGGTGACTGCTCTTTCCTTAATACATGTTTCCACATGGATACCTGCAAGTATGTTCACTATGAAATTGATGCTTGCATGGATTCTGAGGCCCCTGGCAGCAAAGACCACACGCCAAGCCAGGAGCTTGCTCTTACACAGAGTGTCGGAGGTGATTCCAGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tianfang Xia et al.
Pathology, research and practice, 215(11), 152666-152666 (2019-10-14)
Epigenetic modifications are involved in carcinogenesis and METTL3 is involved in RNA methylation. This study aimed to explore the role of the RNA m6A methyltransferase METTL3 in pancreatic cancer cells. The m6A modification was analyzed in human pancreatic cancer and
Jiarong Cai et al.
OncoTargets and therapy, 12, 9143-9152 (2019-12-07)
N6-methyladenosine (m6A) is the most abundant internal modification on eukaryotic mRNA and gained increasing attention recently. More and more evidence suggest that m6A methylation plays crucial role in tumor genesis and development. However, its role in prostate cancer remains largely
Shiyan Gu et al.
Toxicology letters, 292, 1-11 (2018-04-24)
N6-methyladenosine (m6A) modification is implicated to play an important role in cellular biological processes, but its regulatory mechanisms in arsenite-induced carcinogenesis are largely unknown. Here, human bronchial epithelial (HBE) cells were chronically treated with 2.5 μM arsenite sodium (NaAsO2) for about
Daniel A Lorenz et al.
RNA (New York, N.Y.), 26(1), 19-28 (2019-10-19)
Direct RNA sequencing holds great promise for the de novo identification of RNA modifications at single-coordinate resolution; however, interpretation of raw sequencing output to discover modified bases remains a challenge. Using Oxford Nanopore's direct RNA sequencing technology, we developed a
Ly P Vu et al.
Nature medicine, 23(11), 1369-1376 (2017-09-19)
N6-methyladenosine (m6A) is an abundant nucleotide modification in mRNA that is required for the differentiation of mouse embryonic stem cells. However, it remains unknown whether the m6A modification controls the differentiation of normal and/or malignant myeloid hematopoietic cells. Here we

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.