설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTTCAAGGAGCTGTGCAAAAGGAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCTCATACCCTGATGAAAGGAGGAAGCACCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TNFSF11(8600) , TNFSF11(8600)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Aase Haj Hensvold et al.
Arthritis research & therapy, 17, 239-239 (2015-09-05)
Receptor activator of nuclear factor kappa B ligand (RANKL) is a key regulator of bone metabolism. Anti-citrullinated protein antibodies (ACPA) have been suggested to cause bone destruction by osteoclast activation. We investigated the relationship between RANKL and ACPA in patients
Hae-Rim Kim et al.
PloS one, 10(4), e0124909-e0124909 (2015-04-22)
Vascular endothelial growth factor (VEGF) has angiogenic, inflammatory, and bone-destructive roles in rheumatoid arthritis (RA). We aimed to determine the unique role of VEGF in osteoclastogenesis in RA. VEGF-induced receptor activator of nuclear factor ҡB ligand (RANKL) expression was determined
Hong Hu et al.
Breast cancer research and treatment, 146(3), 515-523 (2014-07-11)
The receptor activator of nuclear factor-κB ligand (RANKL) acts as a paracrine factor in progesterone-induced mammary epithelial proliferation and tumorigenesis. This evidence comes mainly from mouse models. Our aim was to examine whether RANKL expression in human normal and malignant
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.