콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU060601

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAGCCACAGATGCTGACAAATGAGAAGCTGTCCATCTTTGATGCCAACGAGTCTGGCTTTGAGAGTTATGAGGCGCTTCCCCAGCACAAACTGACCTGCTTCAGTGTGTACTGTAAGCACGGTCACCTGTGTCCCATCGACACCGGCCTCATCGAGAAGAATATCGAACTCTTCTTTTCTGGTTCAGCAAAACCAATCTATGATGATGACCCATCTCTTGAAGGTGGTGTTAATGGCAAAAATCTTGGCCCCATAAATGAATGGTGGATCACTGGCTTTGATGGAGGTGAAAAGGCCCTCATCGGCTTCAGCACCTCATTTGCCGAATACATTCTGATGGATCCCAGTCCCGAGTATGCGCCCATATTTGGGCTGATGCAGGAGAAGATCTACATCAGCAAGATTGTGGTGGAGTTCCTGCAGAGCAATTCCGACTCGACCTATGAGGACCTGATCAACAAGATCGAGACCACGGTTCCTCCTTCT

Ensembl | 인체 수납 번호

ENSG00000130816

NCBI 수납 번호

NM_001379

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... DNMT1(1786) , DNMT1(1786)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
OAV
NZU
CSU
CRU
TFU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Arunagiri Kuha Deva Magendhra Rao et al.
Molecular oncology, 13(6), 1342-1355 (2019-04-09)
Breast cancer is the most common malignancy among women, with the highest incidence rate worldwide. Dysregulation of long noncoding RNAs during the preliminary stages of breast carcinogenesis is poorly understood. In this study, we performed RNA sequencing to identify long
Shuhao Fu et al.
Experimental eye research, 165, 47-58 (2017-09-13)
The principle reason of high failure rate of glaucoma filtration surgery is the loss of filtration function caused by postoperative scar formation. We investigated the effects of 5-aza-2'-deoxycytidine (5-Aza-dc), a DNA methyltransferases inhibitor, on human Tenon's capsule fibroblasts (HTFs) differentiation
Sumadi Lukman Anwar et al.
World journal of gastroenterology, 23(9), 1568-1575 (2017-03-23)
To screen clinically relevant microRNAs (miRNAs) silenced by DNA methylation in human hepatocellular carcinoma (HCC). Knockdown of DNA methyltransferases (DNMTs) using siRNAs and miRNA profiling in HCC cell lines were performed to identify DNA hypermethylation-mediated miRNA downregulation. Confirmation using individual
Ercan Cacan
Cell biology international, 41(3), 328-339 (2017-01-12)
The immunological response against cancer is a critical balance between immune-activating and immune-suppressing mechanisms. Ovarian cancer creates a suppressive microenvironment to escape immune elimination; however, the molecular mechanisms are poorly understood, and it is unclear whether chemotherapeutic drugs exert an
Luc Gailhouste et al.
Cell death & disease, 9(5), 468-468 (2018-04-28)
Curative management of pancreatic adenocarcinoma is limited because this malignancy remains resistant to most chemotherapeutic drugs. Strategies that reverse epigenetic alterations offer a unique opportunity for cancer cell reprogramming, which is valuable for development of new treatments. The aim of
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.