콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU053481

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK9

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TACGAGAAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAGACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCCATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAACTTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATACCTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAGTTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATCCACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGATGGGGTCCTGAAGCTGGCAGACTTT

Ensembl | 인체 수납 번호

ENSG00000136807

NCBI 수납 번호

NM_001261

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CDK9(1025) , CDK9(1025)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jinglu Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(5), 5990-6000 (2019-02-07)
Despite surgical and chemotherapeutic advances over the past few decades, the prognosis for ovarian cancer remains very poor. Although cyclin-dependent kinase (CDK) 9 has an established pathogenic role in various cancers, its function in ovarian cancer remains poorly defined. The
So-Young Kim et al.
PloS one, 10(12), e0146073-e0146073 (2016-01-01)
Breast cancer cells generally develop resistance to TNF-Related Apoptosis-Inducing Ligand (TRAIL) and, therefore, assistance from sensitizers is required. In our study, we have demonstrated that Spleen tyrosine kinase (Syk) inhibitor Bay 61-3606 was identified as a TRAIL sensitizer. Amplification of
Muhammed H Rahaman et al.
Molecular oncology, 13(10), 2178-2193 (2019-08-10)
Colorectal cancer (CRC) remains one of the most lethal human malignancies, and pursuit of new therapeutic targets for treatment has been a major research focus. Cyclin-dependent kinase 9 (CDK9), which plays a crucial role in transcription, has emerged as a
Nicole Pinto et al.
PloS one, 15(9), e0239315-e0239315 (2020-09-25)
Anaplastic thyroid cancer (ATC) is a rare, but nearly uniformly fatal disease that is typically resistant to chemotherapy and radiation. Alternative strategies to target this cancer at a molecular level are necessary in order to improve dismal outcomes for ATC
Hangzhan Ma et al.
EBioMedicine, 39, 182-193 (2018-12-24)
Cyclin-dependent protein kinase 9 (CDK9) has been shown to play an important role in the pathogenesis of malignant tumors. However, the expression and function of CDK9 remain unknown in osteosarcomas. The purpose of this study is to assess the expression
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.