콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU051131

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBR1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAAGTCATCACCTGGCCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAATGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTAATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTTTACCATTGCTTGTTCAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTT

Ensembl | 인체 수납 번호

ENSG00000106799

NCBI 수납 번호

NM_004612

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TGFBR1(7046) , TGFBR1(7046)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
JUU
NXT
QWT
VRT
GVS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Weitang Liao et al.
Frontiers in physiology, 11, 1093-1093 (2020-10-06)
Renal tubulointerstitial fibrosis is usually the final outcome of various end-stage renal diseases. Recent studies have reported that microRNAs (miRNAs) play an important role in renal fibrosis. However, the biological function of microRNAs in renal fibrosis is complicated and remains
Hilène Lin et al.
Scientific reports, 8(1), 10488-10488 (2018-07-12)
Cartilage loss in osteoarthritis (OA) results from altered local production of growth factors and metalloproteases (MMPs). Furin, an enzyme involved in the protein maturation of MMPs, might regulate chondrocyte function. Here, we tested the effect of furin on chondrocyte catabolism
Lincan Duan et al.
PloS one, 13(7), e0200452-e0200452 (2018-07-12)
In the tumor progression, transforming growth factor β1 (TGFβ1) plays a critical role in tumorigenesis as well as metastasis. It is known that high plasma level of TGFβ1 in patients with advanced non-small cell lung cancer (NSCLC) is correlated with
Kaushal Asrani et al.
The Journal of clinical investigation, 127(11), 4001-4017 (2017-09-26)
Despite its central position in oncogenic intracellular signaling networks, the role of mTORC1 in epithelial development has not been studied extensively in vivo. Here, we have used the epidermis as a model system to elucidate the cellular effects and signaling
Si-Rui Ma et al.
Oncotarget, 6(11), 8807-8821 (2015-04-15)
Anterior gradient protein 2 (AGR2) is a novel biomarker with potential oncogenic role. We sought to investigate the diagnostic and prognostic role of AGR2 on head and neck squamous cell carcinoma (HNSCC) with an emphasis on its correlation of cancer

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.