설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
ACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAGCGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCGAGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGAGGAAGGTCTTCCTGTTTTCACCATCTTTCTAATCTTTTTCCAGCTTGAGGGAGGCGGTATCCACCTGCAGCCCTTTTAGTGGTGGTGTCTCACTCTTTCTTCTCTCTTTGTCCCGGATAGGCTAATCAATACCCTTGGCACTGATGGGCACTGGAAAAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PRNP(5621) , PRNP(5621)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Heather Bender et al.
PloS one, 14(7), e0219995-e0219995 (2019-07-23)
Prion diseases are members of neurodegenerative protein misfolding diseases (NPMDs) that include Alzheimer's, Parkinson's and Huntington diseases, amyotrophic lateral sclerosis, tauopathies, traumatic brain injuries, and chronic traumatic encephalopathies. No known therapeutics extend survival or improve quality of life of humans
Yong-Seok Han et al.
Cell death & disease, 7(10), e2395-e2395 (2016-10-07)
Mesenchymal stem cells (MSCs) are 'adult' multipotent cells that promote regeneration of injured tissues in vivo. However, differences in oxygenation levels between normoxic culture conditions (21% oxygen) and both the MSC niche (2-8% oxygen) and ischemic injury-induced oxidative stress conditions
Stefano Martellucci et al.
International journal of molecular sciences, 20(2) (2019-01-19)
Human Dental Pulp Stem Cells (hDPSCs) represent a type of adult mesenchymal stem cells that have the ability to differentiate in vitro in several lineages such as odontoblasts, osteoblasts, chondrocytes, adipocytes and neurons. In the current work, we used hDPSCs
Stefano Martellucci et al.
Prion, 12(2), 117-126 (2018-04-13)
Cellular prion protein (PrPC) is expressed in a wide variety of stem cells in which regulates their self-renewal as well as differentiation potential. In this study we investigated the presence of PrPC in human dental pulp-derived stem cells (hDPSCs) and
Jin-Young Park et al.
Oncotarget, 6(7), 5342-5353 (2015-03-07)
Hypoxia decreases cytotoxic responses to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) protein. Cellular prion protein (PrPc) is regulated by HIF-1α in neurons. We hypothesized that PrPc is involved in hypoxia-mediated resistance to TRAIL-induced apoptosis. We found that hypoxia induced PrPc
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.