콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU035531

Sigma-Aldrich

MISSION® esiRNA

targeting human UPF1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGACGCCTACCAGTACCAGAACATATTCGGGCCCCTGGTCAAGCTGGAGGCCGACTACGACAAGAAGCTGAAGGAGTCCCAGACTCAAGATAACATCACTGTCAGGTGGGACCTGGGCCTTAACAAGAAGAGAATCGCCTACTTCACTTTGCCCAAGACTGACTCTGACATGCGGCTCATGCAGGGGGATGAGATATGCCTGCGGTACAAAGGGGACCTTGCGCCCCTGTGGAAAGGGATCGGCCACGTCATCAAGGTCCCTGATAATTATGGCGATGAGATCGCCATTGAGCTGCGGAGCAGCGTGGGTGCACCTGTGGAGGTGACTCACAACTTCCAGGTGGATTTTGTGTGGAAGTCGACCTCCTTTGACAGGATGCAGAGCGCATTGAAAACGTTTGCCGTGGATGAGACCTCGGTGTCTGGCTACATCTACCACAAGCTGTTGGGCCACGAGGTGGAGGACGTAAT

Ensembl | 인체 수납 번호

ENSG00000005007

NCBI 수납 번호

NM_002911

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... UPF1(5976) , UPF1(5976)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Seo-Young Lee et al.
Oncogene, 38(10), 1597-1610 (2018-10-24)
The point mutation that substitutes lysine with arginine at position 120 of human p53 has been characterized as a missense mutation. The K120R mutation renders the p53 protein disabled for acetylation and, as a result, defective for apoptotic function, which
Nagakatsu Harada et al.
Journal of cellular biochemistry, 118(11), 3810-3824 (2017-04-07)
Nonsense-mediated mRNA decay (NMD) degrades mRNAs carrying a premature termination codon (PTC) in eukaryotes. Cellular stresses, including endoplasmic reticulum (ER) stress, inhibit NMD, and up-regulate PTC-containing mRNA (PTC-mRNA) levels in several cell lines. However, whether similar effects exist under in
Aparna Kishor et al.
Nucleic acids research, 48(13), 7468-7482 (2020-06-17)
Alternative polyadenylation (APA) produces transcript 3' untranslated regions (3'UTRs) with distinct sequences, lengths, stabilities and functions. We show here that APA products include a class of cryptic nonsense-mediated mRNA decay (NMD) substrates with extended 3'UTRs that gene- or transcript-level analyses
Xiaojun Wang et al.
Environmental toxicology, 35(9), 998-1006 (2020-05-14)
The roles of long noncoding RNA (lncRNA) MACC1-AS1 have been revealed in various tumors. This work aims to explore the roles of lncRNA MACC1-AS1 in the stemness of nonsmall cell lung cancer (NSCLC) cells and the underlying mechanism. We showed
Tereza Grymová et al.
Molecular immunology, 107, 91-96 (2019-01-28)
Mutations in the C1 inhibitor (C1INH) encoding gene, SERPING1, are associated with hereditary angioedema (HAE) which manifests as recurrent submucosal and subcutaneous edema episodes. The major C1INH function is the complement system inhibition, preventing its spontaneous activation. The presented study
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.