콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU033081

Sigma-Aldrich

MISSION® esiRNA

targeting human ACE2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAGCAAACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAATGGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAGATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAAGTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGAACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCAAAGTTGATGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Miki Yamaguchi et al.
Biochemical and biophysical research communications, 487(3), 613-618 (2017-04-24)
EGFR-mutant lung adenocarcinomas contain a subpopulation of cells that have undergone epithelial-to-mesenchymal transition and can grow independently of EGFR. To kill these cancer cells, we need a novel therapeutic approach other than EGFR inhibitors. If a molecule is specifically expressed
Yingchuan Li et al.
Scientific reports, 5, 8209-8209 (2015-02-04)
ACE2 and Ang-(1-7) have important roles in preventing acute lung injury. However, it is not clear whether upregulation of the ACE2/Ang-(1-7)/Mas axis prevents LPS-induced injury in pulmonary microvascular endothelial cells (PMVECs) by inhibiting the MAPKs/NF-κB pathways. Primary cultured rat PMVECs
Xi Cao et al.
Diabetes/metabolism research and reviews, 35(4), e3123-e3123 (2019-01-04)
Previous works indicated that the stress on the endoplasmic reticulum (ER) affected nonalcoholic fatty liver disease (NAFLD). However, there is no clear evident on the effect of the regulation of ER stress by angiotensin-converting enzyme 2 (ACE2) on the prevention

프로토콜

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.