콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU023471

Sigma-Aldrich

MISSION® esiRNA

targeting human NT5E

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CGGAAGGTTCCTGTAGTCCAGGCCTATGCTTTTGGCAAATACCTAGGCTATCTGAAGATCGAGTTTGATGAAAGAGGAAACGTCATCTCTTCCCATGGAAATCCCATTCTTCTAAACAGCAGCATTCCTGAAGATCCAAGCATAAAAGCAGACATTAACAAATGGAGGATAAAATTGGATAATTATTCTACCCAGGAATTAGGGAAAACAATTGTCTATCTGGATGGCTCCTCTCAATCATGCCGCTTTAGAGAATGCAACATGGGCAACCTGATTTGTGATGCAATGATTAACAACAACCTGAGACACACGGATGAAATGTTCTGGAACCACGTATCCATGTGCATTTTAAATGGAGGTGGTATCCGGTCGCCCATTGATGAACGCAACAATGGCACAATTACCTGGGAGAACCTGGCTGCTGTATTGCCCTTTGGAGGCACATTTGACCTAGTCCAGTTAAAAGGTTCCACCCTGAAGAAGGCCTTTGAGCAT

Ensembl | 인체 수납 번호

ENSG00000135318

NCBI 수납 번호

NM_002526

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NT5E(4907) , NT5E(4907)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jaden S Lee et al.
Virulence, 11(1), 414-429 (2020-05-19)
Cell surface nucleotide-metabolizing enzyme, ectonucleotidase-CD73, has emerged as a central component of the cellular homeostatic-machinery that counterbalances the danger-molecule (extracellular-ATP)-driven proinflammatory response in immune cells. While the importance of CD73 in microbial host fitness and symbiosis is gradually being unraveled
Young Mun Jeong et al.
Cancers, 12(10) (2020-10-23)
CD73 is involved in tumor immune escape and promotes the growth and progression of cancer cells. The functional role of CD73 expression in papillary thyroid carcinoma (PTC) has not yet been established. In 511 patients with PTC, immunohistochemistry for CD73
Brett Verstak et al.
Journal of leukocyte biology, 96(3), 427-436 (2014-05-09)
TLRs act as sentinels in professional immune cells to detect and initiate the innate immune response to pathogen challenge. TLR4 is a widely expressed TLR, responsible for initiating potent immune responses to LPS. TRAM acts to bridge TLR4 with TRIF
Xiao-Yu Shi et al.
Asian Pacific journal of tropical medicine, 7(10), 787-791 (2014-08-19)
To explore the effect of Fibulin-5 expression on cell proliferation and invasion in human gastric cancer patients. Fibulin-5 expression was detected in 56 samples of surgically resected gastric cancer and paired noncancerous tissues using qRT-PCR and immunoblotting. Fibulin-5 was knocked
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.