설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TXNRD1(7296) , TXNRD1(7296)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yichong Wang et al.
Oncology reports, 37(5), 2905-2912 (2017-04-14)
Aberrant neovascularization supports nutrients and the oxygen microenvironment in tumour growth, invasion and metastasis. Recapitulation of functional microvascular structures in vitro could provide a platform for the study of vascular conditions. Sulforaphane (SFN), an isothiocyanate, has been reported to possess chemopreventive
MicroRNA-124 regulates the radiosensitivity of non-small cell lung cancer cells by targeting TXNRD1.
Chuncheng Hao et al.
Oncology letters, 13(4), 2071-2078 (2017-04-30)
Radiation treatment remains one of the major modalities in the treatment of lung cancer. Although the majority of patients initially respond to treatment with radiation, resistance inevitably develops and leads to treatment failure. Therefore, the identification of the underlying molecular
Xinzhi Wang et al.
Redox biology, 24, 101153-101153 (2019-03-26)
The early immature CD34+ acute myeloid leukemia (AML) cell subpopulation-acute myeloid leukemia progenitor cells (APCs), is often resistant to conventional chemotherapy, making them largely responsible for the relapse of AML. However, to date, the eradication of APCs remains a major
Bo Ra You et al.
Molecular carcinogenesis, 53(11), 847-857 (2013-05-11)
Zebularine (Zeb) is a DNA methyltransferase (DNMT) inhibitor to that has an anti-tumor effect. Here, we evaluated the anti-growth effect of Zeb on A549 lung cancer cells in relation to reactive oxygen species (ROS) levels. Zeb inhibited the growth of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.