Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU228341

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR9, RP11-330H6.5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGTCACCAGCCTTTCCTTGTCCTCCAACCGCATCCACCACCTCCATGATTCTGACTTTGCCCACCTGCCCAGCCTGCGGCATCTCAACCTCAAGTGGAACTGCCCGCCGGTTGGCCTCAGCCCCATGCACTTCCCCTGCCACATGACCATCGAGCCCAGCACCTTCTTGGCTGTGCCCACCCTGGAAGAGCTAAACCTGAGCTACAACAACATCATGACTGTGCCTGCGCTGCCCAAATCCCTCATATCCCTGTCCCTCAGCCATACCAACATCCTGATGCTAGACTCTGCCAGCCTCGCCGGCCTGCATGCCCTGCGCTTCCTATTCATGGACGGCAACTGTTATTACAAGAACCCCTGCAGGCAGGCACTGGAGGTGGCCCCGGGTGCCCTCCTTGGCCTGGGCAACCTCACCCACCTGTCACTCAAGTACAACAACCTCACTGTGGTGCCCCGCAACCTGCCTTCCAGCCTGGAGTATCTGCTGTTGTCCTACAACCGCATCGTCAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU228341-50UG:
EHU228341-20UG:


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Misty Good et al.
American journal of physiology. Gastrointestinal and liver physiology, 306(11), G1021-G1032 (2014-04-20)
Necrotizing enterocolitis (NEC) is the leading cause of death from gastrointestinal disease in premature infants and develops partly from an exaggerated intestinal epithelial immune response to indigenous microbes. There has been interest in administering probiotic bacteria to reduce NEC severity
Xiaoling Gu et al.
Free radical biology & medicine, 83, 149-158 (2015-03-17)
An increasing number of studies have focused on the phenomenon that mitochondrial DNA (mtDNA) activates innate immunity responses. However, the specific role of mtDNA in inflammatory lung disease remains elusive. This study was designed to examine the proinflammatory effects of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service