Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU039321

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pak2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGGCAAGAGGTTGCTATCAAGCAGATTAATTTACAGAAACAACCAAAGAAGGAATTGATCATTAATGAAATTCTGGTGATGAAAGAGTTAAAGAATCCCAACATAGTTAACTTCTTGGACAGTTACCTGGTAGGAGATGAGTTGTTTGTGGTAATGGAGTACCTCGCTGGTGGGTCCCTCACTGATGTTGTAACAGAAACCTGCATGGACGAAGCGCAGATTGCCGCCGTGTGCAGAGAGTGTTTACAGGCGTTGGAGTTTTTACATGCTAATCAAGTGATCCACAGAGACATCAAAAGTGACAATGTGCTTTTGGGAATGGAAGGCTCAGTTAAACTTACTGACTTCGGCTTCTGTGCCCAGATCACTCCTGAACAGAGCAAACGCAGTACTATGGTTGGAACACCGTACTGGATGGCACCAGAGGTGGTGACACGGAAAGCCTATGGTCCCAAAGTTGACATATGGTCTCTGGGCATCATGGCTATCGAGATGGTTGAAGGAGAGC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ting Shuang et al.
FEBS letters, 589(20 Pt B), 3154-3164 (2015-09-13)
MiR-134 has been reported to have a role in the development and progression of various cancers. In this study, we found that miR-134 expression was significantly decreased in chemo-resistant serous epithelial ovarian cancer (EOC) patients. Over-expression of miR-134 enhanced the
Elizabeth Flate et al.
International journal of oncology, 45(4), 1401-1411 (2014-07-23)
The interaction between tumor cells and extracellular matrix (ECM) proteins influences cell migration and the invasive behavior of cancer cells. In this study, we provide experimental evidence that collagen I and fibronectin affect ovarian cancer cell migration. In vitro wound healing assays
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.