Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU148311

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA1A (2)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTCAAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTGCTGGACAAGTGTCAAGAGGTCATCTCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAGCTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGGCCTGGGGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAGGAGGTAGATTAGGGGCCTTTCCAAGATTGCTGTTTTTGTTTTGGAGCTTCAAGACTTTGCATTTCCTAGTATTTCTGTTTGTCAGTTCTCAATTTCCTGTGTTTGCAATGTTGAAATTTTTTGGTGAAGTACTGAACTTGCTTTTTTTCCGGTTTCTACATGCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ilse M Beck et al.
PloS one, 8(7), e69115-e69115 (2013-08-13)
Compound A possesses glucocorticoid receptor (GR)-dependent anti-inflammatory properties. Just like classical GR ligands, Compound A can repress NF-κB-mediated gene expression. However, the monomeric Compound A-activated GR is unable to trigger glucocorticoid response element-regulated gene expression. The heat shock response potently
Chungen Yan et al.
International journal of clinical and experimental medicine, 8(4), 5746-5752 (2015-07-02)
To explore the ultrasound-guided gene transfection as well as the role of heat shock protein 72 (HSP72) siRNA combined with ultrasound micro-bubble contrast agents on rat hepatic ischemia-reperfusion injury. 72 SD rats were divided into non-surgery group (group N), sham-operation
Taek-Keun Kim et al.
Biochemical and biophysical research communications, 469(2), 222-228 (2015-12-15)
Heat shock protein 70-1A (HSP70-1A) is a stress-inducible protein that provides an essential intracellular molecular chaperone function; however, the mechanism of HSP70-1A in angiogenesis has not been clarified. Herein, HSP70-1A gene silencing implicated this protein in angiogenesis. Additionally, recombinant human
Salvador Mena et al.
PloS one, 7(9), e44524-e44524 (2012-09-08)
The phenolic phytoalexin resveratrol is well known for its health-promoting and anticancer properties. Its potential benefits are, however, limited due to its low bioavailability. Pterostilbene, a natural dimethoxylated analog of resveratrol, presents higher anticancer activity than resveratrol. The mechanisms by

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.