Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU147561

Sigma-Aldrich

MISSION® esiRNA

targeting human PKM

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACG

N° accesso Ensembl | uomo

ENSG00000067225

N° accesso NCBI

NM_002654

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PKM(5315) , PKM2(5315)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Pu-Hyeon Cha et al.
British journal of cancer, 124(3), 634-644 (2020-10-20)
Most cancer cells employ the Warburg effect to support anabolic growth and tumorigenesis. Here, we discovered a key link between Warburg effect and aberrantly activated Wnt/β-catenin signalling, especially by pathologically significant APC loss, in CRC. Proteomic analyses were performed to
Hai Hu et al.
Journal of Cancer, 11(8), 2022-2031 (2020-03-05)
Macrophages play a critical role in the initiation and progression in various human solid tumors; however, their role and transformation in pancreatic ductal adenocarcinoma (PDAC) were still illusive. Here, immunohistochemistry was used to determine CD206 (specific marker of M2 macrophage)
Yong Liu et al.
Oncotarget, 8(43), 75206-75216 (2017-11-02)
Platinum-based chemotherapeutic drugs are irreplaceable for the treatment of advanced non-small cell lung cancer (NSCLC). However, acquired drug resistance has become a major obstacle for the clinical application of chemotherapy on NSCLC. In the present study, we established carboplatin-resistant NSCLC
Yang-Hui Bi et al.
World journal of gastroenterology, 25(16), 1936-1949 (2019-05-16)
Study shows that signal transducer and activator of transcription 3 (STAT3) can increase the Warburg effect by stimulating hexokinase 2 in breast cancer and upregulate lactate dehydrogenase A and pyruvate dehydrogenase kinase 1 in myeloma. STAT3 and pyruvate kinase M2
Qingran Li et al.
Molecular & cellular proteomics : MCP, 17(8), 1531-1545 (2018-05-10)
Butyrate is a short chain fatty acid present in a high concentration in the gut lumen. It has been well documented that butyrate, by serving as an energetic metabolite, promotes the proliferation of normal colonocytes while, by serving as a
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.