Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU119551

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAGCTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTCAGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTCACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGCAGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTGCTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCTACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCCCCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGGCCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGT

N° accesso Ensembl | uomo

ENSG00000184557

N° accesso NCBI

NM_003955

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SOCS3(9021) , SOCS3(9021)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ranu Surolia et al.
American journal of physiology. Lung cellular and molecular physiology, 311(5), L928-L940 (2016-11-04)
Pulmonary infections with nontuberculous mycobacteria (P-NTM), such as by Mycobacterium avium complex (M. avium), are increasingly found in the elderly, but the underlying mechanisms are unclear. Recent studies suggest that adaptive immunity is necessary, but not sufficient, for host defense
Naotoshi Iwahara et al.
Journal of Alzheimer's disease : JAD, 55(3), 1235-1247 (2016-11-05)
In response to changes of the central nervous system environment, microglia are capable of acquiring diverse phenotypes for cytotoxic or immune regulation and resolution of injury. Alzheimer's disease (AD) pathology also induces several microglial activations, resulting in production of pro-inflammatory
Mandy Boontanrart et al.
Journal of neuroimmunology, 292, 126-136 (2016-03-06)
Microglia become activated immune cells during infection or disease in the central nervous system (CNS). However, the mechanisms that downregulate activated microglia to prevent immune-mediated damage are not completely understood. Vitamin D3 has been suggested to have immunomodulatory affects, and
Rak-Kyun Seong et al.
Pathogens (Basel, Switzerland), 9(3) (2020-03-04)
Zika virus (ZIKV) is a mosquito-borne flavivirus that has emerged and caused global outbreaks since 2007. Although ZIKV proteins have been shown to suppress early anti-viral innate immune responses, little is known about the exact mechanisms. This study demonstrates that
Yan Zhang et al.
Journal of neuroinflammation, 14(1), 211-211 (2017-11-04)
Morphine tolerance is a clinical challenge, and its pathogenesis is closely related to the neuroinflammation mediated by Toll-like receptor 4 (TLR4). In Chinese pain clinic, lidocaine is combined with morphine to treat chronic pain. We found that lidocaine sufficiently inhibited
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.