Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU111091

Sigma-Aldrich

MISSION® esiRNA

targeting human XIAP

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAACAAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATCCTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAATTCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ke Ren et al.
Pathology oncology research : POR, 25(1), 341-348 (2017-11-11)
To find the exact downstream effector of Pim-2 pathway in prostate cancer cells, and to determine the means by which it affects prostate cancer. XIAP, Pim-2 and p-eIF4B expressions were detected in PCA and BPH tissues. Then the Pim-2 and
Ying Hou et al.
Journal of cell science, 130(2), 502-511 (2016-12-09)
Regulation of cell death is crucial for the response of cancer cells to drug treatments that cause arrest in mitosis, and is likely to be important for protection against chromosome instability in normal cells. Prolonged mitotic arrest can result in
Morikazu Miyamoto et al.
Anticancer research, 38(1), 301-306 (2017-12-27)
To investigate whether XIAP down-regulation and autophagy inhibition sensitize ovarian clear cell cancer cells to cisplatin. The ovarian clear cancer cell line KK was used for in vitro analysis. Hydroxychloroquine (HCQ) and phenoxodiol (PXD) or embelin were used as autophagy
Xiaodi Li et al.
International journal of oncology, 51(1), 327-335 (2017-06-01)
MicroRNAs play a crucial role in gene expression regulation in various types of cancers. Previous studies show the expression level of miR‑146a‑5p is downregulated in epithelial ovarian cancer. Further investigations suggest this downregulation is responsible for apoptosis resistance in ovarian
Rachel Coyle et al.
International journal of oncology, 55(1), 191-202 (2019-05-23)
Malignant rhabdoid tumour (MRT) is a rare, aggressive paediatric neoplasm, primarily diagnosed in those below the age of three. MRTs most commonly arise in the central nervous system and kidneys. A poor prognosis accompanies the MRT diagnosis, with a reported

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.