Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU107461

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6KB1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATCCCTTCATCGTGGATTTAATTTATGCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGGAGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAAACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Suleman S Hussain et al.
Cancer letters, 433, 232-241 (2018-07-14)
Radiation therapy (XRT) is a standard treatment for prostate cancer (PCa). Although dose escalation increases local control, toxicity hampers further escalation. Broader improvement will be possible by the addition of adjuvant therapies, which can synergize with radiation and thus improve
Subin Jin et al.
Journal of Korean medical science, 32(8), 1327-1336 (2017-07-01)
Microarray analysis was used to investigate the lack of identified mammalian target of rapamycin (mTOR) pathway downstream genes to overcome cross-talk at non-muscle invasive high-grade (HG)-urothelial carcinoma (UC) of the bladder, gene expression patterns, gene ontology, and gene clustering by
Tao Zhang et al.
International journal of molecular sciences, 15(2), 3154-3171 (2014-02-26)
The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), either alone or in combination with other anti-cancer agents, has been considered as a new strategy for anti-cancer therapy. In this study, we demonstrated that evodiamine, a quinolone alkaloid isolated from the fruit
Ju Hyun Shin et al.
Scientific reports, 3, 1561-1561 (2013-03-28)
There is growing interest in identifying regulators of autophagy. The molecular mechanism underlying transforming growth factor-β activated kinase 1 (TAK1)-induced autophagy is poorly understood. We found that TAK1 inhibits p70 S6 kinase1 (S6K1) phosphorylation by interfering interaction of raptor with
Ye Wang et al.
International journal of radiation biology, 93(6), 581-589 (2017-03-10)
Ribosomal S6 kinase 1 (S6K1) plays an important role in cell proliferation, protein translation and cell survival. This study investigated the possibility of using S6K1 as a new target in the radiotherapy of non-small cell lung cancer (NSCLC) and its

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.