Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU092591

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF3 (1)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTTTCTCAGATCTGGTTTCTAAGAGTTTTGGGGGGCGGGGCTGTCACCACGTGCAGTATCTCAAGATATTCAGGTGGCCAGAAGAGCTTGTCAGCAAGAGGAGGACAGAATTCTCCCAGCGTTAACACAAAATCCATGGGCAGTATGATGGCAGGTCCTCTGTTGCAAACTCAGTTCCAAAGTCACAGGAAGAAAGCAGAAAGTTCAACTTCCAAAGGGTTAGGACTCTCCACTCAATGTCTTAGGTCAGGAGTTGTGTCTAGGCTGGAAGAGCCAAAGAATATTCCATTTTCCTTTCCTTGTGGTTGAAAACCACAGTCAGTGGAGAGATGTTTGGAAACCACAGTCAGTGGAGCCTGGGTGGTACCCAGGCTTTAGCATTATTGGATGTCAATAGCA

N° accesso Ensembl | uomo

ENSG00000162772

N° accesso NCBI

NM_001040619

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ATF3(467) , ATF3(467)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chun-Chao Chen et al.
European journal of pharmacology, 859, 172542-172542 (2019-07-19)
Nicorandil is an adenosine triphosphate-sensitive potassium channel opener with additional antioxidant properties. Doxorubicin (DOX) is an anticancer drug that exerts oxidation-mediated adverse cardiovascular effects. This study examined the effects of nicorandil on DOX-induced cytotoxicity in human umbilical vein endothelial cells
Shunyan Weng et al.
BMC gastroenterology, 16, 25-25 (2016-02-27)
Hepatocellular carcinoma (HCC) is one of most common and aggressive human malignancies in the world, especially, in eastern Asia, and its mortality is very high at any phase. We want to investigate mechanism of niclosamide inducing cell apoptosis in HCC.
Siqi Ma et al.
International journal of molecular medicine, 35(6), 1561-1573 (2015-04-16)
Glioblastomas are highly malignant gliomas that are extremely invasive with high rates of recurrence and mortality. It has been reported that activating transcription factor 3 (ATF3) is expressed in elevated levels in multiple malignant tumors. The purpose of this study
Liugen Gu et al.
Pathology, research and practice, 214(6), 862-870 (2018-05-03)
Intestinal epithelial cell (IEC) apoptosis plays a vital role in the pathogenesis of Crohn's disease (CD), which is an inflammatory bowel disease (IBD). Activating transcription factor 3 (ATF3) modulates apoptosis under stress via regulating the p53 pathway. However, the expression
Genaro Hernandez et al.
Science translational medicine, 12(525) (2020-01-10)
The exocrine pancreas expresses the highest concentrations of fibroblast growth factor 21 (FGF21) in the body, where it maintains acinar cell proteostasis. Here, we showed in both mice and humans that acute and chronic pancreatitis is associated with a loss
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.