Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU057101

Sigma-Aldrich

MISSION® esiRNA

targeting human PINK1, PINK1-AS

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGGAGTGTGAAACGCTCTGCCAGGCAGCCCTCCTCCTCTGCTCATGGAGGGCAGCCCTGTGATGTCCCTGCATGGAGCTGGTGAATTACTAAAAGAACATGGCATCCTCTGTGTCGTGATGGTCTGTGAATGGTGAGGGTGGGAGTCAGGAGACAAGACAGCGCAGAGAGGGCTGGTTAGCCGGAAAAGGCCTCGGGCTTGGCAAATGGAAGAACTTGAGTGAGAGTTCAGTCTGCAGTCCTCTGCTCACAGACATCTGAAAAGTGAATGGCCAAGCTGGTCTAGTAGATGAGGCTGGACTGAGGAGGGGTAGGCCTGCATCCACAGAGAGGATCCAGGCCAAGGCACTGGCTGTCAGTGGCAGAGTTTGGCTGTGACCTTTGCCCCTAACACGAGGAACTCGTTTGAAGGGGGCAGCGTAGCATGTCTGATTTGCCACCTGGAT

N° accesso Ensembl | uomo

ENSG00000158828

N° accesso NCBI

NM_032409

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PINK1(65018) , PINK1(65018)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

C-N Yang et al.
International endodontic journal, 52(5), 676-688 (2018-12-12)
To assess the connection between mitophagy and hypoxia-induced apoptosis in osteoblasts and whether simvastatin alleviates bone resorption in apical periodontitis through modulation of mitophagy-related apoptosis. Hypoxia-induced generation of reactive oxygen species in mitochondria and changes in mitochondrial membrane potential were
Yuan Xu et al.
Molecular neurobiology, 56(1), 252-266 (2018-04-25)
There is emerging evidence suggesting that neurotoxic insults and hypoxic/ischemic injury are underlying causes of Parkinson's disease (PD). Since PTEN-induced kinase 1 (PINK1) dysfunction is involved in the molecular genesis of PD and since our recent studies have demonstrated that
Yan Gao et al.
Biochemical pharmacology, 177, 113997-113997 (2020-05-01)
Alzheimer's disease (AD) is an irreversible neurodegenerative brain disorder with complex pathogenesis. The fibrillar peptide β-amyloid (Aβ) has a chief function in the pathogenesis of AD. Emerging evidence has indicated that there is a tight relationship between inflammation, mitochondrial dysfunction
Limin Wei et al.
International journal of nanomedicine, 12, 1891-1903 (2017-03-24)
With the increasing application of zinc oxide nanoparticles (ZnO NPs) in biological materials, the neurotoxicity caused by these particles has raised serious concerns. However, the underlying molecular mechanisms of the toxic effect of ZnO NPs on brain cells remain unclear.
Juan Liu et al.
Nature communications, 8(1), 1823-1823 (2017-11-29)
Mutations in E3 ubiquitin ligase Parkin have been linked to familial Parkinson's disease. Accumulating evidence suggests that Parkin is a tumor suppressor, but the underlying mechanism is poorly understood. Here we show that Parkin is an E3 ubiquitin ligase for
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.