Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU033081

Sigma-Aldrich

MISSION® esiRNA

targeting human ACE2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGCAAACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAATGGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAGATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAAGTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGAACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCAAAGTTGATGA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Miki Yamaguchi et al.
Biochemical and biophysical research communications, 487(3), 613-618 (2017-04-24)
EGFR-mutant lung adenocarcinomas contain a subpopulation of cells that have undergone epithelial-to-mesenchymal transition and can grow independently of EGFR. To kill these cancer cells, we need a novel therapeutic approach other than EGFR inhibitors. If a molecule is specifically expressed
Yingchuan Li et al.
Scientific reports, 5, 8209-8209 (2015-02-04)
ACE2 and Ang-(1-7) have important roles in preventing acute lung injury. However, it is not clear whether upregulation of the ACE2/Ang-(1-7)/Mas axis prevents LPS-induced injury in pulmonary microvascular endothelial cells (PMVECs) by inhibiting the MAPKs/NF-κB pathways. Primary cultured rat PMVECs
Xi Cao et al.
Diabetes/metabolism research and reviews, 35(4), e3123-e3123 (2019-01-04)
Previous works indicated that the stress on the endoplasmic reticulum (ER) affected nonalcoholic fatty liver disease (NAFLD). However, there is no clear evident on the effect of the regulation of ER stress by angiotensin-converting enzyme 2 (ACE2) on the prevention

Protocolli

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.