Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

View All Documentation

EHU015441

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF6

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCCTAGTCCAAAGCGAAGAGTTGTCTGTGTGATGATAGTATTGGCATTTATAATACTGAACTATGGACCTATGAGCATGTTGGAACAGGATTCCAGGAGAATGAACCCTAGTGTGAGCCCTGCAAATCAAAGGAGGCACCTTCTAGGATTTTCTGCTAAAGAGGCACAGGACACATCAGATGGTATTATCCAGAAAAACAGCTACAGATATGATCATTCTGTTTCAAATGACAAAGCCCTGATGGTGCTAACTGAAGAACCATTGCTTTACATTCCTCCACCTCCTTGTCAGCCCCTAATTAACACAACAGAGTCTCTCAGGTTAAATCATGAACTTCGAGGATGGGTTCATAGACATGAAGTAGAAAGGACCAAGTCAAGAAGAATGACAAATAATCAACAGAAAACCCGTATTCTTCAGGGTGCTCTGGAACAGGGCTCAAATTCTCAGCTGATGGCTGTTCAATACACAGAAACCACTAGTAGTATCAGCAGGAACTCAGGGAGT

N° accesso Ensembl | uomo

ENSG00000118217

N° accesso NCBI

NM_007348

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ATF6(22926) , ATF6(22926)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Patricia Freis et al.
Oncotarget, 8(13), 20974-20987 (2017-04-21)
mTOR and Unfolded Protein Response (UPR) are two signaling pathways frequently activated in cancer cells. The mTOR pathway has been shown to be up-regulated in most gastroenteropancreatic neuroendocrine tumors. In contrast, little is known about the UPR status in neoplastic
Weilin Xu et al.
Frontiers in neuroscience, 12, 638-638 (2018-10-05)
Neuronal apoptosis is an important factor accounting for the poor outcomes of intracerebral hemorrhage (ICH). This study first showed that inhibition of activating transcription factor 6 (ATF6) could alleviate secondary brain injury through anti-apoptosis after ICH in rats. Melatonin, ATF6
Rui Zhou et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(5), 2397-2420 (2018-12-12)
Lipid droplets (LDs) are dynamic organelles that store neutral lipids during times of energy excess, and an increased accumulation of LDs in the liver is closely linked to hepatic steatosis. Our previous studies suggested that resveratrol (RSV) supplement could improve
To Sing Fung et al.
Virology, 533, 34-44 (2019-05-15)
Coronavirus infection induces the generation of autophagosomes, and certain host proteins regulating cellular autophagy are hijacked by some coronaviruses to facilitate the formation of double membrane vesicles. However, mechanisms underlying coronavirus-induced autophagy remain largely unknown. In this study, we demonstrate
A M Merlot et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2094-2110 (2019-04-15)
The metastasis suppressor, N-myc downstream regulated gene-1 (NDRG1), is a stress response protein that is involved in the inhibition of multiple oncogenic signaling pathways. Initial studies have linked NDRG1 and the endoplasmic reticulum (ER) stress response. Considering this, we extensively

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.