Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU012921

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCG2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTATCCGTGGTGTGTCTGGAGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTTATCACTGATCCTTCCATCTTGTTCTTGGATGAGCCTACAACTGGCTTAGACTCAAGCACAGCAAATGCTGTCCTTTTGCTCCTGAAAAGGATGTCTAAGCAGGGACGAACAATCATCTTCTCCATTCATCAGCCTCGATATTCCATCTTCAAGTTGTTTGATAGCCTCACCTTATTGGCCTCAGGAAGACTTATGTTCCACGGGCCTGCTCAGGAGGCCTTGGGATACTTTGAATCAGCTGGTTATCACTGTGAGGCCTATAATAACCCTGCAGACTTCTTCTTGGACATCATTAATGGAGATTCCACTGCTGTGGCATTAAACAGAGAAGAAGACTTTAAAGCCACAGAGATCATAGAGCCTTCCAAGCAGG

N° accesso Ensembl | uomo

ENSG00000118777

N° accesso NCBI

NM_004827

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ABCG2(9429) , ABCG2(9429)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Simran Kaur et al.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 87, 104662-104662 (2020-12-06)
The lengthy TB chemotherapeutic regimen, resulting in the emergence of drug resistance strains, poses a serious problem in the cure of the disease. Further, one-quarter of the world's population is infected with dormant M.tb, which creates a lifetime risk of
Hisakazu Komori et al.
Biochimica et biophysica acta, 1860(5), 973-980 (2018-01-11)
Hyperuricemia has been recognized as an independent risk factor for cardiovascular disease. Urate stimulates NADPH oxidase and induces production of reactive oxygen species (ROS); consequently, intracellular urate accumulation can induce oxidative stress leading to endothelial dysfunction. Here, we studied the
Long Chen et al.
Oncotarget, 8(26), 43237-43247 (2017-06-08)
We analyzed the role of ABCG2, a drug transporter, in determining the sensitivity of glioma stem cells (GSCs) to demethoxycurcumin (DMC). We first demonstrated that ABCG2 is more highly expressed in GSCs than primary astrocytes. Modulation of ABCG2 levels in
Junqing Wang et al.
Oncotarget, 8(3), 5256-5267 (2016-12-29)
ABCG2, member of ATP-binding cassette (ABC) transporter family, is known as crucial regulator related to multi-drug resistance in human tumors and has recently been putatively studied as human carcinoma cell biomarker. While, effects of ABCG2 on human gastric cancer (GC)
Kang Xu et al.
Phytotherapy research : PTR, 33(6), 1717-1725 (2019-04-25)
Inflammation is considered to be one of the initial critical factors in the occurrence of calcific heart valve disease. This study was to prove Nobiletin (NBT) inhibits inflammation-caused calcification of human valve interstitial cells (hVICs) and to elucidate the involved
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.