Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

View All Documentation

EHU008611

Sigma-Aldrich

MISSION® esiRNA

targeting human IFIH1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGCATGGAGGAGGAACTGTTGACAATTGAAGACAGAAACCGGATTGCTGCTGCAGAAAACAATGGAAATGAATCAGGTGTAAGAGAGCTACTAAAAAGGATTGTGCAGAAAGAAAACTGGTTCTCTGCATTTCTGAATGTTCTTCGTCAAACAGGAAACAATGAACTTGTCCAAGAGTTAACAGGCTCTGATTGCTCAGAAAGCAATGCAGAGATTGAGAATTTATCACAAGTTGATGGTCCTCAAGTGGAAGAGCAACTTCTTTCAACCACAGTTCAGCCAAATCTGGAGAAGGAGGTCTGGGGCATGGAGAATAACTCATCAGAATCATCTTTTGCAGATTCTTCTGTAGTTTCAGAATCAGACACAAGTTTGGCAGAAGGAAGTGTCAGCTGCTTAGATGAAAGTCTTGGACATAACAGCAACATGGGCA

N° accesso Ensembl | uomo

ENSG00000115267

N° accesso NCBI

NM_022168

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IFIH1(64135) , IFIH1(64135)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Seung Bum Park et al.
PloS one, 11(7), e0158419-e0158419 (2016-07-13)
Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I
Shogo Kawaguchi et al.
Inflammation, 42(6), 2095-2104 (2019-08-24)
The molecular mechanisms of innate immunity are closely associated with the development of non-alcoholic fatty liver disease (NAFLD). TNF-α is a key cytokine involved in the pathogenesis of metabolic inflammation like NAFLD. Melanoma differentiation-associated gene 5 (MDA5) is a member
Chia-Lin Chen et al.
Nature communications, 8, 13882-13882 (2017-01-10)
B-cell infection by hepatitis C virus (HCV) has been a controversial topic. To examine whether HCV has a genetically determined lymphotropism through a co-receptor specific for the infection by lymphotropic HCV, we established an infectious clone and chimeric virus of
Iwona A Buskiewicz et al.
Science signaling, 9(456), ra115-ra115 (2016-12-03)
The increased expression of genes induced by type I interferon (IFN) is characteristic of viral infections and systemic lupus erythematosus (SLE). We showed that mitochondrial antiviral signaling (MAVS) protein, which normally forms a complex with retinoic acid gene I (RIG-I)-like
Tongtian Zhuang et al.
Cell death & disease, 11(6), 453-453 (2020-06-14)
Vitiligo is a disfiguring disease featuring chemokines-mediated cutaneous infiltration of autoreactive CD8+ T cells that kill melanocytes. Copious studies have indicated that virus invasion participates in the pathogenesis of vitiligo. IFIH1, encoding MDA5 which is an intracellular virus sensor, has
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.