Skip to Content
Merck
All Photos(1)

Key Documents

EHU009401

Sigma-Aldrich

MISSION® esiRNA

targeting human LIFR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGATGCACCTCCCCATTAATTCTACTGTGGAAGATATAGCTGCAGAAGAGGACTTAGATAAAACTGCGGGTTACAGACCTCAGGCCAATGTAAATACATGGAATTTAGTGTCTCCAGACTCTCCTAGATCCATAGACAGCAACAGTGAGATTGTCTCATTTGGAAGTCCATGCTCCATTAATTCCCGACAATTTTTGATTCCTCCTAAAGATGAAGACTCTCCTAAATCTAATGGAGGAGGGTGGTCCTTTACAAACTTTTTTCAGAACAAACCAAACGATTAACAGTGTCACCGTGTCACTTCAGTCAGCCATCTCAATAAGCTCTTACTGCTAGTGTTGCTACATCAGCACTGGGCATTCTTGGAGGGATCCTGTGAAGTATTGTTAGGAGGTGAACTTCACTACATGTTAAGTTACACTGAAAGTGTTCATGTGCTTTTAATGTAGTCTAAAAGCCAAAGTATAGTGACTCAGAATCCTCAATCCACAAAACTCAAGATTGGGAGCTCTTTGTGATCAAGCCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qin Luo et al.
Oncotarget, 6(9), 6989-6999 (2015-03-10)
Differential diagnosis of well-differentiated hepatocellular carcinoma (WD-HCC) and high-grade dysplastic nodules (HGDNs) represents a challenge for pathologists. Several immunohistochemistry markers have been identified to distinguish hepatocellular carcinoma (HCC) from HGDNs. However, sensitivity or specificity of the individual marker is still
Chengyong Lei et al.
DNA and cell biology, 37(8), 659-669 (2018-06-15)
The role of leukemia inhibitory factor receptor (LIFR), which is important in the signal transduction of the interleukin-6 cytokine family, is still undefined in clear cell renal cell carcinoma (ccRCC). Thus, we examined the function and mechanism of LIFR in
Hao-Xuan Wu et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2769-2784 (2018-05-12)
Leukemia inhibitory factor receptor (LIFR) has been documented as a cancer promoter and to be present at high levels in various types of tumor tissues. In our search for molecules prognostic of colorectal cancer (CRC), we found high levels of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service