Skip to Content
Merck
All Photos(1)

Key Documents

EHU026721

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCTTTGTCAGCCAATCACAGTTTGAAACCTTTGCCCTCTGTTCCAGAAGAGAAAAAGCCCAGGCATAAAATCATCTCCATATTCTCAGGCACAGAGAAAGGAAGTAAAAAGAAAGAAAAGGAACGGCCAGAAATTTCTCCTCCATCTGATTTTGAGCACACCATCCATGTTGGCTTTGATGCTGTTACTGGAGAATTCACTGGCATGCCAGAACAGTGGGCTCGATTACTACAGACCTCCAATATCACCAAACTAGAGCAAAAGAAGAATCCTCAGGCTGTGCTGGATGTCCTAAAGTTCTACGACTCCAACACAGTGAAGCAGAAATATCTGAGCTTTACTCCTCCTGAGAAAGATGGCTTTCCTTCTGGAACACCAGCACTGAATGCCAAGGGAACAGAAGCACCCGCAGTAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ting Shuang et al.
FEBS letters, 589(20 Pt B), 3154-3164 (2015-09-13)
MiR-134 has been reported to have a role in the development and progression of various cancers. In this study, we found that miR-134 expression was significantly decreased in chemo-resistant serous epithelial ovarian cancer (EOC) patients. Over-expression of miR-134 enhanced the
Elizabeth Flate et al.
International journal of oncology, 45(4), 1401-1411 (2014-07-23)
The interaction between tumor cells and extracellular matrix (ECM) proteins influences cell migration and the invasive behavior of cancer cells. In this study, we provide experimental evidence that collagen I and fibronectin affect ovarian cancer cell migration. In vitro wound healing assays
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service