Skip to Content
Merck
All Photos(1)

Key Documents

EHU086711

Sigma-Aldrich

MISSION® esiRNA

targeting human GGCT

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAAAGGTCTCAGAAGAAATTGAAGACATCATCAAAAAGGGGGAAACACAAACTCTTTAGAACATAACAGAATATATCTAAGGGTATTCTATGTGCTAATATAAAATATTTTTAACACTTGAGAACAGGGATCTGGGGGATCTCCACGTTTGATCCATTTTCAGCAGTGCTCTGAAGGAGTATCTTACTTGGGTGATTCCTTGTTTTTAGACTATAAAAAGAAACTGGGATAGGAGTTAGACAATTTAAAAGGGGTGTATGAGGGCCTGAAATATGTGACAAATGAATGTGAGTACCCCTTCTGTGAACACTGAAAGCTATTCTCTTGAATTGATCTTAAGTGTCTCCTTGCTCTGGTAAAAGATAGATTTGTAGCTCACTTGATGATGGTGCTGGTGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eiki Hanada et al.
Anticancer research, 39(4), 1893-1898 (2019-04-07)
γ-Glutamylcyclotransferase (GGCT), a key enzyme involved in glutathione metabolism, catalyzes a specific reaction that generates 5-oxoproline and free amino acids from the γ-glutamyl peptide. Inhibition of GGCT is a promising therapeutic strategy for the treatment of various cancers. Immuno-histochemistry was
Hiroko Takagi et al.
Anticancer research, 39(9), 4811-4816 (2019-09-15)
γ-Glutamylcyclotransferase (GGCT) is highly expressed in many forms of cancer, and is a promising therapeutic target. The present study investigated whether inhibition of GGCT enhanced the antiproliferative effects of the drug docetaxel in prostate cancer cells. Immunohistochemistry and western blot
Tetsuyuki Takahashi et al.
Biochemical and biophysical research communications, 516(2), 388-396 (2019-06-21)
Inhibition of prostaglandin E2 signaling via EP2/EP4 prostanoid receptors suppresses Insulin-like growth factor (IGF)-1-induced proliferation of pancreatic cancer BxPC-3 cells. To better understand the mechanism of EP2/EP4 signaling for controlling cell proliferation, we performed metabolome analyses in BxPC-3 cells treated with IGF-1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service