Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU028861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdkn1c

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTAGAGGCTAACGGCCAGAGAGAACTTGCTGGGCATCTGGGCAGCGGACGATGGAAGAACTCTGGGCTTCGGCTGGGACCTTTCGTTCATGTAGCAGGAACCGGAGATGGTTGCGTAGAGCAGCCCACGGTTTTGTGGAAATCTGAAAACTGTGCAATGTATTGAGAACACTCTGTACCATGTGCAAGGAGTACGCTGGTCCCAAGGTGTAAAGCTTTAAATCATTTATGTAAAATGTTTAATCTCTACTCGCTCTCAGTGCAAAACAAAAAGAGAAACTAGAAAATGTAGAACGAAGGAAAAAGATGAGAAAAAGGAAAAAGCATGTATATTTGTACAAAAAGTTAAAAAATTATGCTAATTTAATATTTGTATTTATCCATGCGTGGATCCCTCTGCCACGCAACTGCTGGGTTATTGATTATTACCAAAGGCACTAGAAATCACCAGCTTCAGATTACCCA

Numéro d'accès Ensembl | souris

ENSMUSG00000037664

Numéro d'accès NCBI

NM_009876

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CDKN1C(12577) , Cdkn1c(12577)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

H M Coley et al.
British journal of cancer, 106(3), 482-489 (2012-01-12)
Carboplatin remains a first-line agent in the management of epithelial ovarian cancer (EOC). Unfortunately, platinum-resistant disease ultimately occurs in most patients. Using a novel EOC cell line with acquired resistance to carboplatin: PEO1CarbR, genome-wide micro-array profiling identified the cyclin-dependent kinase
Elizabeth M Algar et al.
PloS one, 4(2), e4482-e4482 (2009-02-18)
SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to
Hui Guo et al.
BMC gastroenterology, 15, 104-104 (2015-08-15)
Our previous research suggested that p57 downregulation could accelerate the growth and invasion of hepatocellular carcinoma in vitro and in vivo. To evaluate the role of cytoplasmic p57 and its regulatory mechanism during hepatocellular carcinoma invasion. We examined the subcellular
Jihong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 7-14 (2015-05-12)
MicroRNAs (miRNA) have oncogenic or tumor-suppressive roles in the development and growth of human glioma. Glioma development is also associated with alteration in the activities and expression of cell cycle regulators, and miRNAs are emerging as important regulators of cell

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique