Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU024721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCGTTCTGCACGAGTGTCTATGAGGTGCCGCGCCTCCGGGAACGGGAACGCTCTCTTCCAGTTCTCAGACACACTCACTGGTCCTGATGTTTGCCCACCCTACCGCGTCCAGCCACAGTCCCAGGGTTCATAGCGATCCATCTCTCCCACCTCCTACCTGGGGACTCCTGAAACCACTTGCCTGAGTCGGCTCGAACCCTTTTGCCATCCTGAGGGCCCTGACCCAGCCTACCTCCCTCCCTCTTTGAGGGAGACTCCTTTTGCACTGCCCCCCAATTTGGCCAGAGGGTGAGAGAAAGATTCTTCTTCTGGGGTGGGGGTGGGGAGGTCAACTCTTGAAGGTGTTGCGGTTCCTGATGTATTTTGCGCTGTGACCTCTTTGGGTATTATCACCTTTCCTTGTCTCTCAGGTCCCTATAGGTCCCTTGAGTTCTCTAACCAGCACCTCTGGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Megan M Weivoda et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(1), 76-85 (2015-06-26)
Osteoblast-mediated bone formation is coupled to osteoclast-mediated bone resorption. These processes become uncoupled with age, leading to increased risk for debilitating fractures. Therefore, understanding how osteoblasts are recruited to sites of resorption is vital to treating age-related bone loss. Osteoclasts
Jian Cao et al.
Prostaglandins & other lipid mediators, 116-117, 76-86 (2015-02-14)
Myocardial infarction (MI) is complicated by ventricular fibrosis and associated diastolic and systolic failure. Emerging studies implicate Wnt1 signaling in the formation of new blood vessels. Epoxyeicosatrienoic acids (EETs)-mediated up-regulation of heme oxygenase-1 (HO-1) protects against the detrimental consequences of
Han Yan et al.
Molecular carcinogenesis, 53(12), 960-969 (2013-07-19)
The epithelial-mesenchymal transition (EMT) and acquisition of cancer stem cells (CSCs)-like properties are essential steps in the metastasis and postsurgical recurrence of hepatocellular carcinomas (HCCs). The molecular mechanisms involved, however, remain obscure. As determined by an miRNA microarray analysis, there

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique