Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU132051

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAGCCAGCGCTACAAAGTTGACTACGAGTCTCAGAGCACAGATACCCAGAACTTCTCCTCCGAGTCCAAGCGGGAGACAGAATATGGTCCCTGCCGTAGAGAAATGGAAGACACACTGAATCACCTGAAGTTCCTCAATGTGCTGAGTCCCAGGGGTGTACACATTCCCAACTGTGACAAGAAGGGATTTTATAAGAAAAAGCAGTGTCGCCCTTCCAAAGGCAGGAAGCGGGGCTTCTGCTGGTGTGTGGATAAGTATGGGCAGCCTCTCCCAGGCTACACCACCAAGGGGAAGGAGGACGTGCACTGCTACAGCATGCAGAGCAAGTAGACGCCTGCCGCAAGGTTAATGTGGAGCTCAAATATGCCTTATTTTGCACAAAAGACTGCCAAGGACATGACC

Numéro d'accès Ensembl | humain

ENSG00000146674

Numéro d'accès NCBI

NM_000598

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IGFBP3(3486) , IGFBP3(3486)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lili Bao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15043-15052 (2016-09-24)
Insulin-like growth factor-binding protein-3 (IGFBP3) is an N-linked glycosylated, phosphorylated protein, which has been reported to regulate cancer progression and metastasis. However, the role of IGFBP3 in tumor metastasis remains under debate. Nasopharyngeal carcinoma (NPC) is a highly metastatic head
Wei Zhou et al.
Oncology reports, 37(2), 1075-1083 (2016-12-22)
MicroRNAs play critical roles in the progression of acute lymphoblastic leukemia (ALL). Previous studies have indicated that miR-196b and miR-1290 play critical roles in T-cell ALL (T-ALL) and B-cell ALL (B-ALL), respectively. Resveratrol, a natural edible polyphenolic phytoalexin, possesses certain
Huiwen Wang et al.
Cancer management and research, 12, 1007-1015 (2020-02-28)
Chemotherapeutic treatment of hepatocellular carcinoma (HCC) has always been plagued by nonspecific and side effects. Plant extracts have potential anticancer capabilities with low cytotoxicity and few side effects, but their detailed mechanisms are still unclear, thus limiting their clinical applications.
Chang-Ling Li et al.
Journal of molecular and cellular cardiology, 139, 98-112 (2020-01-27)
Salvianolic acid B (Sal B) is the representative component of phenolic acids derived from the dried root and rhizome of Salvia miltiorrhiza Bge. (Labiatae), which has been widely used for the treatment of cardiovascular and cerebrovascular diseases. However, the effect
Yan He et al.
Fitoterapia, 124, 200-205 (2017-11-21)
Insulin-like growth factor I (IGF-I) and binding protein 3 (IGFBP-3) play a role in the maintenance of gut mucosal barrier function. Nevertheless, IGF-I/IGFBP-3 and tight junction protein (TJP) expression in small intestinal mucosa are often impaired during endotoxemia. In this
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique