Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU129261

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK6, BUB1B-PAK6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCTGGACAGCTACGTGAAGATTGGCGAGGGCTCCACCGGCATCGTCTGCTTGGCCCGGGAGAAGCACTCGGGCCGCCAGGTGGCCGTCAAGATGATGGACCTCAGGAAGCAGCAGCGCAGGGAGCTGCTCTTCAACGAGGTGGTGATCATGCGGGACTACCAGCACTTCAACGTGGTGGAGATGTACAAGAGCTACCTGGTGGGCGAGGAGCTGTGGGTGCTCATGGAGTTCCTGCAGGGAGGAGCCCTCACAGACATCGTCTCCCAAGTCAGGCTGAATGAGGAGCAGATTGCCACTGTGTGTGAGGCTGTGCTGCAGGCCCTGGCCTACCTGCATGCTCAGGGTGTCATCCACCGGGACATCAAGAGTGACTCCATCCTGCTGACCCTCGATGGCAGGGTGAAGCTCTCGGACTTCGGATTCTGTGCTCAGATCAGCAAAGACGTCCCTAAGAGGAAGTCCCTGGTGGGAACCCCCTACTGGATGGCTCCTGAAGTGATCTCCAGGTCTTTGTATGCCACTGAGGTGGATATCTGGTCTCTGGGCATCATGGTGATTGAGATGGTAGATGGGGAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Daniel Pensold et al.
Cerebral cortex (New York, N.Y. : 1991), 27(12), 5696-5714 (2017-11-09)
The proliferative niches in the subpallium generate a rich cellular variety fated for diverse telencephalic regions. The embryonic preoptic area (POA) represents one of these domains giving rise to the pool of cortical GABAergic interneurons and glial cells, in addition
Sally Fram et al.
Cellular and molecular life sciences : CMLS, 71(14), 2759-2773 (2013-12-20)
p-21 activated 6 (PAK6), first identified as interacting with the androgen receptor (AR), is over-expressed in multiple cancer tissues and has been linked to the progression of prostate cancer, however little is known about PAK6 function in the absence of
Jian Zhai et al.
Biochemical and biophysical research communications, 464(1), 161-167 (2015-06-28)
Emerging evidence suggests that microRNAs (miRNAs) play important roles in regulating HCC development and progression; however, the mechanisms by which their specific functions and mechanisms remained to be further explored. miR-129 has been reported in gastric cancers, lung cancer and
Songwang Cai et al.
Oncotarget, 6(6), 3904-3917 (2015-02-26)
Here we found that levels of miR-23a were decreased in prostate cancer cell lines and tumor tissues. These low levels were associated with poor patients' prognosis. MiR-23a inhibited migration and invasion of prostate cancer in vivo and in orthotopic prostate
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique