Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU086711

Sigma-Aldrich

MISSION® esiRNA

targeting human GGCT

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAAAGGTCTCAGAAGAAATTGAAGACATCATCAAAAAGGGGGAAACACAAACTCTTTAGAACATAACAGAATATATCTAAGGGTATTCTATGTGCTAATATAAAATATTTTTAACACTTGAGAACAGGGATCTGGGGGATCTCCACGTTTGATCCATTTTCAGCAGTGCTCTGAAGGAGTATCTTACTTGGGTGATTCCTTGTTTTTAGACTATAAAAAGAAACTGGGATAGGAGTTAGACAATTTAAAAGGGGTGTATGAGGGCCTGAAATATGTGACAAATGAATGTGAGTACCCCTTCTGTGAACACTGAAAGCTATTCTCTTGAATTGATCTTAAGTGTCTCCTTGCTCTGGTAAAAGATAGATTTGTAGCTCACTTGATGATGGTGCTGGTGAAT

Numéro d'accès Ensembl | humain

ENSG00000006625

Numéro d'accès NCBI

NM_024051

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GGCT(79017) , GGCT(79017)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eiki Hanada et al.
Anticancer research, 39(4), 1893-1898 (2019-04-07)
γ-Glutamylcyclotransferase (GGCT), a key enzyme involved in glutathione metabolism, catalyzes a specific reaction that generates 5-oxoproline and free amino acids from the γ-glutamyl peptide. Inhibition of GGCT is a promising therapeutic strategy for the treatment of various cancers. Immuno-histochemistry was
Hiroko Takagi et al.
Anticancer research, 39(9), 4811-4816 (2019-09-15)
γ-Glutamylcyclotransferase (GGCT) is highly expressed in many forms of cancer, and is a promising therapeutic target. The present study investigated whether inhibition of GGCT enhanced the antiproliferative effects of the drug docetaxel in prostate cancer cells. Immunohistochemistry and western blot
Tetsuyuki Takahashi et al.
Biochemical and biophysical research communications, 516(2), 388-396 (2019-06-21)
Inhibition of prostaglandin E2 signaling via EP2/EP4 prostanoid receptors suppresses Insulin-like growth factor (IGF)-1-induced proliferation of pancreatic cancer BxPC-3 cells. To better understand the mechanism of EP2/EP4 signaling for controlling cell proliferation, we performed metabolome analyses in BxPC-3 cells treated with IGF-1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique