Accéder au contenu
Merck
Toutes les photos(2)

Key Documents

EHU083501

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT1, RP11-982M15.2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(2)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC

Numéro d'accès Ensembl | humain

ENSG00000142208

Numéro d'accès NCBI

NM_005163

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... AKT1(207) , AKT1(207)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gang Shen et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 798-809 (2018-10-12)
Bromodomain-containing protein 4 (BRD4) overexpression participates in prostate cancer progression by enhancing the transcriptional activity and expression of several key oncogenes. AZD5153 is a novel BRD4 inhibitor. Prostate cancer cells were treated with AZD5153. Cell survival was tested by MTT
Sisi Chen et al.
Experimental hematology, 45, 74-84 (2016-10-25)
Although practiced clinically for more than 40 years, the use of hematopoietic stem cell (HSC) transplantation remains limited by the inability to expand functional HSCs ex vivo. To determine the role of phosphoinositide 3-kinase (PI3K)/AKT signaling in human hematopoietic stem and progenitor
Guoxing Xu et al.
Scientific reports, 7, 42411-42411 (2017-02-17)
Recent studies have shown that some members of the tripartite motif-containing protein (TRIM) family serve as important regulators of tumorigenesis. However, the biological role of TRIM14 in osteosarcoma remains to be established. In this study, we showed that TRIM14 is
Farrukh Aqil et al.
Cancer letters, 449, 186-195 (2019-02-17)
Gene-silencing with targeted siRNAs has great potential as a therapeutic approach for various diseases including cancer. However, intracellular delivery of siRNA is challenging. We used bovine milk exosomes as a novel system for siRNA delivery. First, we demonstrated that exosomes
Alexander Kretschmer et al.
Scientific reports, 9(1), 7826-7826 (2019-05-28)
Tunneling nanotubes (TNTs) are actin-based membranous structures bridging distant cells for intercellular communication. We define roles for TNTs in stress adaptation and treatment resistance in prostate cancer (PCa). Androgen receptor (AR) blockade and metabolic stress induce TNTs, but not in
Afficher tous les articles scientifiques apparentés

Articles

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique