Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU067201

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGGCAAAATGCCAGTTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGTCCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCATAAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGAAGTGGCACAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guo-Qing Sui et al.
American journal of cancer research, 7(5), 1177-1187 (2017-06-01)
microRNA-338-3p (miR-338-3p) has been implicated in tumor development and progression in many types of cancers. However, the function and mechanism underlying the action of miR-383-3p in thyroid cancer remain unclear and were therefore investigated in this study by
Kohji Noguchi et al.
The Journal of biological chemistry, 292(5), 1910-1924 (2016-12-29)
The suppression of mitotic Aurora kinases (AURKs) by AURK inhibitors frequently causes cytokinetic failure, leading to polyploidy or aneuploidy, indicating the critical role of AURK-mediated phosphorylation during cytokinesis. We demonstrate the deregulated expression of AKT3 in Aurora kinase inhibitor (AURKi)-resistant
Nikolaus A Watson et al.
Nature communications, 11(1), 1684-1684 (2020-04-05)
There are thousands of known cellular phosphorylation sites, but the paucity of ways to identify kinases for particular phosphorylation events remains a major roadblock for understanding kinase signaling. To address this, we here develop a generally applicable method that exploits
Jade Peres et al.
Oncotarget, 6(3), 1821-1833 (2015-01-18)
The AKT3 signalling pathway plays a critical role in melanoma formation and invasion and components of this signalling cascade are therefore attractive targets for the treatment of malignant melanoma. Recent evidence show that the embryonically important TBX3 transcription factor is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique