Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU076701

Sigma-Aldrich

MISSION® esiRNA

targeting human TAZ

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACAAGTCGGCTGTGGAGATGCGGAAAGCCCTGACGGACTTCATTCAAGAGGAATTCCAGCATCTGAAGACTCAGGCAGAGCAGCTCCACAACCACCTCCAGCCTGGGAGATAGGCCTTGCTTGCTGCCTTCTGGATTCTTGGCCCGCACAGAGCTGGGGCTGAGGGATGGACTGATGCTTTTAGCTCAAACGTGGCTTTTAGACAGATTTGTTCATAGACCCTCTCAAGTGCCCTCTCCGAGCTGGTAGGCATTCCAGCTCCTCCGTGCTTCCTCAGTTACACAAAGGACCTCAGCTGCTTCTCCCACTTGGCCAAGCAGGGAGGAAGAAGCTTAGGCAGGGCTCTCTTTCCTTCTTGCCTTCAGATGTTCTCTCCCAGGGGCTGGCTTCAGGAGGGAGCATAGA

Numéro d'accès Ensembl | humain

ENSG00000102125

Numéro d'accès NCBI

NM_000116

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TAZ(6901) , TAZ(6901)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenguang Chang et al.
Molecular nutrition & food research, 63(7), e1801322-e1801322 (2019-01-12)
High fat (HF)-diet-induced insulin resistance is a major contributor to the pathogenesis of cardiovascular diseases. However, the molecular mechanisms that regulate cardiac insulin signaling are not fully understood. The regulatory role of tafazzin in the hearts of HF-diet-fed mice is
Libo Yan et al.
Archives of biochemistry and biophysics, 562, 31-36 (2014-08-01)
The Hippo-YAP pathway is altered and implicated as an oncogenic signaling pathway in many human cancers. Hypoxia is an important microenvironmental factor that promotes tumorigenesis. However, the effects of hypoxia on the two most important Hippo-YAP effectors, YAP (Yes-associated protein)
M Shanzer et al.
Oncogene, 34(32), 4190-4198 (2014-11-05)
The polyomavirus middle T antigen (PyMT) is an oncogene that activates the non-receptor tyrosine kinase, c-Src, and physically interacts with Taz (WWTR1). Taz is a pro-oncogenic transcription coactivator of the Tead transcription factors. The Hippo tumor suppressor pathway activates the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique