Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU032751

Sigma-Aldrich

MISSION® esiRNA

targeting human THBS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGGAATTGGTGATGCCTGTGATGATGACGATGACAATGATAAAATTCCAGATGACAGGGACAACTGTCCATTCCATTACAACCCAGCTCAGTATGACTATGACAGAGATGATGTGGGAGACCGCTGTGACAACTGTCCCTACAACCACAACCCAGATCAGGCAGACACAGACAACAATGGGGAAGGAGACGCCTGTGCTGCAGACATTGATGGAGACGGTATCCTCAATGAACGGGACAACTGCCAGTACGTCTACAATGTGGACCAGAGAGACACTGATATGGATGGGGTTGGAGATCAGTGTGACAATTGCCCCTTGGAACACAATCCGGATCAGCTGGACTCTGACTCAGACCGCATTGGAGATACCTGTGACAACAATCAGGATATTGATGAAGATGGCCACCAGAAC

Numéro d'accès Ensembl | humain

ENSG00000137801

Numéro d'accès NCBI

NM_003246

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... THBS1(7057) , THBS1(7057)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hui Hu et al.
Clinical science (London, England : 1979), 133(14), 1629-1644 (2019-07-19)
Background: Our previous studies observed that administration of exosomes from endothelial progenitor cells (EPC) facilitated vascular repair in the rat model of balloon injury. However, the molecular events underlying this process remain elusive. Here, we aim to interrogate the key
Jeneen Panezai et al.
Immunology, 152(2), 308-327 (2017-06-06)
Cell adhesion is generally considered to depend on positive regulation through ligation of integrins and cytokine receptors. However, here we show that T-cell adhesion, and notably also T-cell receptor (TCR) -induced activation, are subject to constant suppression through shedding of
Gun-Hoo Park et al.
Nature neuroscience, 23(11), 1352-1364 (2020-10-25)
The mechanisms by which prenatal immune activation increase the risk for neuropsychiatric disorders are unclear. Here, we generated developmental cortical interneurons (cINs)-which are known to be affected in schizophrenia (SCZ) when matured-from induced pluripotent stem cells (iPSCs) derived from healthy
Albin Jeanne et al.
Oncotarget, 6(20), 17981-18000 (2015-06-06)
The multi-modular glycoprotein thrombospondin-1 (TSP-1) is considered as a key actor within the tumor microenvironment. Besides, TSP-1 binding to CD47 is widely reported to regulate cardiovascular function as it promotes vasoconstriction and angiogenesis limitation. Therefore, many studies focused on targeting

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique