Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU009401

Sigma-Aldrich

MISSION® esiRNA

targeting human LIFR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAGATGCACCTCCCCATTAATTCTACTGTGGAAGATATAGCTGCAGAAGAGGACTTAGATAAAACTGCGGGTTACAGACCTCAGGCCAATGTAAATACATGGAATTTAGTGTCTCCAGACTCTCCTAGATCCATAGACAGCAACAGTGAGATTGTCTCATTTGGAAGTCCATGCTCCATTAATTCCCGACAATTTTTGATTCCTCCTAAAGATGAAGACTCTCCTAAATCTAATGGAGGAGGGTGGTCCTTTACAAACTTTTTTCAGAACAAACCAAACGATTAACAGTGTCACCGTGTCACTTCAGTCAGCCATCTCAATAAGCTCTTACTGCTAGTGTTGCTACATCAGCACTGGGCATTCTTGGAGGGATCCTGTGAAGTATTGTTAGGAGGTGAACTTCACTACATGTTAAGTTACACTGAAAGTGTTCATGTGCTTTTAATGTAGTCTAAAAGCCAAAGTATAGTGACTCAGAATCCTCAATCCACAAAACTCAAGATTGGGAGCTCTTTGTGATCAAGCCAA

Numéro d'accès Ensembl | humain

ENSG00000113594

Numéro d'accès NCBI

NM_002310

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LIFR(3977) , LIFR(3977)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qin Luo et al.
Oncotarget, 6(9), 6989-6999 (2015-03-10)
Differential diagnosis of well-differentiated hepatocellular carcinoma (WD-HCC) and high-grade dysplastic nodules (HGDNs) represents a challenge for pathologists. Several immunohistochemistry markers have been identified to distinguish hepatocellular carcinoma (HCC) from HGDNs. However, sensitivity or specificity of the individual marker is still
Chengyong Lei et al.
DNA and cell biology, 37(8), 659-669 (2018-06-15)
The role of leukemia inhibitory factor receptor (LIFR), which is important in the signal transduction of the interleukin-6 cytokine family, is still undefined in clear cell renal cell carcinoma (ccRCC). Thus, we examined the function and mechanism of LIFR in
Hao-Xuan Wu et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2769-2784 (2018-05-12)
Leukemia inhibitory factor receptor (LIFR) has been documented as a cancer promoter and to be present at high levels in various types of tumor tissues. In our search for molecules prognostic of colorectal cancer (CRC), we found high levels of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique