Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU158861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cblb

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCCAAGCTTCAGTTGAAAAACAGCCCACCGTATATACTTGATATTTTACCTGATACGTATCAGCACTTGAGACTTATATTGAGTAAATATGATGACAACCAGAAGCTGGCTCAACTGAGCGAGAATGAGTACTTTAAAATCTACATCGATAGTCTCATGAAGAAGTCGAAGCGAGCGATCCGGCTCTTTAAAGAAGGCAAGGAAAGGATGTACGAAGAGCAGTCGCAGGACAGACGGAATCTCACAAAGCTGTCCCTTATCTTCAGTCACATGCTGGCAGAAATCAAGGCGATCTTTCCCAATGGCCAGTTCCAGGGAGATAACTTCCGGATCACCAAAGCAGATGCTGCTGAGTTCTGGAGGAAGTTTTTTGGAGACAAAACTATTGTACCATGGAAAGTCTTCAGACAGTGCCTGCATGAGGTCCATCAGATCAGCTCTGGCCTGGAAGCAATGGCTCTGAAGTCAACCATTGATTTAACTTGCAATGATTACATCTCAGTGTTTGAATTTG

Ensembl | nº de acceso | ratón

ENSMUSG00000022637

Nº de acceso NCBI

NM_001033238

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CBLB(208650) , Cblb(208650)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei-Xia Yang et al.
FEBS letters, 589(15), 1975-1980 (2015-06-27)
Orosomucoid 1-Like Protein 3 (ORMDL3) is an asthma candidate gene and Casitas B lineage lymphoma b (Cbl-b), an E3 ubiquitin ligase, is a critical factor in maintaining airway immune tolerance. However, the association of Cbl-b with ORMDL3 for asthma is
Noah Joseph et al.
FEBS letters, 588(21), 3808-3815 (2014-09-15)
The Nck adapter protein is involved in key cellular functions, such as actin polymerization and reorganization, serving as a molecular bridge between the surface complex essential for foreign antigen recognition, the T-cell antigen receptor (TCR), and the actin machinery. However
Yubo Cao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 5607-5615 (2015-02-24)
Mammalian target of rapamycin (mTOR) has emerged as a new potential therapeutic target for gastric cancer. However, a phase III clinical trial found that monotherapy with the mTOR inhibitor everolimus did not significantly improve the overall survival of patients with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico