Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU094631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ybx1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGCAGGAGAGCAAGGTAGACCAGTGAGACAGAATATGTATCGCCCTTACAGACCACGATTCCGAAGGGGCCCTCCTCGCCAAAGACAGCCTAGAGAGGATGGCAATGAAGAGGACAAAGAAAATCAAGGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTATCGCCGAAACTTCAATTACCGACGCAGACGCCCAGAGAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAACGCCGGCTTACCATCTCTACCATCATCCGGTTTGGTCATCCAACAAGAAGAAATGAATATGAAATTCCAGCAATAAGAAATGAACAAAGATTGGAGCTGAAGACCTTAAGTGCTTGAGCTTTTTGCC

Ensembl | nº de acceso | ratón

ENSMUSG00000028639

Nº de acceso NCBI

NM_011732

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... YBX1(22608) , Ybx1(22608)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mohammad Imran Khan et al.
Oncotarget, 5(9), 2462-2474 (2014-04-29)
Epithelial-to-mesenchymal transition (EMT) plays an important role in prostate cancer (PCa) metastasis. The transcription/translation regulatory Y-box binding protein-1 (YB-1) is known to be associated with cancer metastasis. We observed that YB-1 expression increased with tumor grade and showed an inverse
Bing-Hua Su et al.
Oncotarget, 6(35), 38308-38326 (2015-10-31)
Conditionally replicating adenoviruses (CRAds), or oncolytic adenoviruses, such as E1B55K-deleted adenovirus, are attractive anticancer agents. However, the therapeutic efficacy of E1B55K-deleted adenovirus for refractory solid tumors has been limited. Environmental stress conditions may induce nuclear accumulation of YB-1, which occurs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico