Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU090241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGGTAGAAGAGGCCATTAGTGAGGAACTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGATTTCACACTCCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACTTGAAGATGCTGAACCATGCACCCAGTGTCCAGATTCATGATGTCCCGGCAGACCTCCTGACGTATGACAGGACTGACGAGGCCGACGCTGAAGAGAGAGGTCCCGAGGAGAACTACAGCAGGCCAGAAGCACCCAATGAGTTCTATGATGGCGACCATGACAACGACAAGGAAAGTTGATGTGGAGATTTAGAGCAGCATGGATGCTGTGTCCCAAGAGTTCCTTGTCACCTCTGTGGTGGGAAGGAAAGTATGGTTTCCCCAGGTCTGAACTGGGTACCCCCAGGGTGTTTACTAACTCTGGTGAAGGGTTTGGAAACCATATGTGGTTCTAGAATTAACTCCCTTTCCTCAAACTCTCACGGCCTGATGATTGTCCCTCTCAGGGATGAGACATGGACA

Ensembl | nº de acceso | ratón

ENSMUSG00000024454

Nº de acceso NCBI

NM_010411

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... HDAC3(15183) , Hdac3(15183)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Olga S Safronova et al.
Nucleic acids research, 42(14), 8954-8969 (2014-07-25)
Hypoxia is associated with a variety of physiological and pathological conditions and elicits specific transcriptional responses. The elongation competence of RNA Polymerase II is regulated by the positive transcription elongation factor b (P-TEFb)-dependent phosphorylation of Ser2 residues on its C-terminal
S S Roy et al.
Oncogene, 33(28), 3707-3716 (2013-08-27)
Tumor metastasis is the leading cause of death among breast cancer patients. PELP1 (proline, glutamic acid and leucine rich protein 1) is a nuclear receptor coregulator that is upregulated during breast cancer progression to metastasis and is an independent prognostic
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico