Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU062931

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vegfa

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCACGACAGAAGGAGAGCAGAAGTCCCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTACTGCCGTCCGATTGAGACCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTTCAAGCCGTCCTGTGTGCCGCTGATGCGCTGTGCAGGCTGCTGTAACGATGAAGCCCTGGAGTGCGTGCCCACGTCAGAGAGCAACATCACCATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAGCAGATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAATCACTGTGAGCCTTGTTCAGAGCGGAGAAAGCATT

Ensembl | nº de acceso | ratón

ENSMUSG00000023951

Nº de acceso NCBI

NM_001025257

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... VEGFA(22339) , Vegfa(22339)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yang Ding et al.
Biomaterials, 35(25), 7214-7227 (2014-05-31)
We described here the mechanisms by which small interfering RNA (siRNA) molecules incorporated in reconstituted high density lipoprotein (rHDL) were efficiently transferred into the cytoplasm of cells to perform target-specific therapy of tumor angiogenesis. Using fluorescent-tagged apolipoprotein A-I (apoA-I) and
Xue-jun Shao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(5), 2051-2062 (2015-07-24)
Down-expression of microRNA-497 (miR-497) was often found in malignancies. The purposes of this study were to determine the expression of miR-497 in human osteosarcoma and to establish the association between miR-497 expression with cell survival and the sensitivity to cisplatin
Tingting Li et al.
International journal of nanomedicine, 10, 4279-4291 (2015-07-15)
Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI)-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (sh)RNA
Yinan Wang et al.
PloS one, 10(6), e0130341-e0130341 (2015-06-16)
The transcription factor Krüppel-like factor 4 (KLF4) has been implicated in regulating cell proliferation, migration and differentiation in a variety of human cells and is one of four factors required for the induction of pluripotent stem cell reprogramming. However, its
Zhili Wen et al.
PloS one, 9(9), e104666-e104666 (2014-09-25)
MicroRNAs have been appreciated in various cellular functions, including the regulation of angiogenesis. Mesenchymal-stem-cells (MSCs) transplanted to the MI heart improve cardiac function through paracrine-mediated angiogenesis. However, whether microRNAs regulate MSC induced angiogenesis remains to be clarified. Using microRNA microarray
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico