Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU055721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGACGGGAATAAGTTCCTTTCAGTCTGTTTCTACACTGTCATCTTAGACTTTGCCTGAGACTGATTCCTGGACATCTCTACCAGTCCTCGCTCTTACAGTTAGCAGGGGCACCTTCTGACATCCCTGACCAGCCAAGGGTCTTCACCCTCACCACCTTTCACTCACATGAAACCATATACACAGACACTCCAGTTTTGTTTTTGCATGAAATTGTATCTCAGTCTAAGGTCTCATGCTGTTGCTGCTACTGTCTTACTATTATAGCAACCTTCAGAAGTAATTTCACAATCTTTGGGAGTCATGAGCCCATTGTTCATTTGTGCATCAAGTGTCATCTTTTGGTTTTTGGTTTTCCCTAGCAGTGAAGGCTAAATGAGATACACTGATTCTAGGTACATTGTTAACTTTCTAGGAGATAAATCAAGAACTAATTAGACTAAGAAGATTTAGTTTATATTTCTGAACAAGCAATTGTTGAAGGGTGGTGGTG

Ensembl | nº de acceso | ratón

ENSMUSG00000019699

Nº de acceso NCBI

NP_035915

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... AKT3(23797) , Akt3(23797)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

X Qian et al.
Oncogene, 33(26), 3411-3421 (2013-08-27)
N-cadherin and HER2/neu were found to be co-expressed in invasive breast carcinomas. To test the contribution of N-cadherin and HER2 in mammary tumor metastasis, we targeted N-cadherin expression in the mammary epithelium of the MMTV-Neu mouse. In the context of
Jade Peres et al.
Oncotarget, 6(3), 1821-1833 (2015-01-18)
The AKT3 signalling pathway plays a critical role in melanoma formation and invasion and components of this signalling cascade are therefore attractive targets for the treatment of malignant melanoma. Recent evidence show that the embryonically important TBX3 transcription factor is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico