Saltar al contenido
Merck
Todas las fotos(2)

Key Documents

EHU083501

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT1, RP11-982M15.2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(2)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAATCCGATTCACGTAGGGAAATGTTAAGGACTTCTGCAGCTATGCGCAATGTGGCATTGGGGGGCCGGGCAGGTCCTGCCCATGTGTCCCCTCACTCTGTCAGCCAGCCGCCCTGGGCTGTCTGTCACCAGCTATCTGTCATCTCTCTGGGGCCCTGGGCCTCAGTTCAACCTGGTGGCACCAGATGCAACCTCACTATGGTATGCTGGCCAGCACCCTCTCCTGGGGGTGGCAGGCACACAGCAGCCCCCCAGCACTAAGGCCGTGTCTCTGAGGACGTCATCGGAGGCTGGGCCCCTGGGATGGGACCAGGGATGGGGGATGGGCCAGGGTTTACCCAGTGGGACAGAGGAGCAAGGTTTAAATTTGTTATTGTGTATTATGTTGTTCAAATGCATTTTGGGGGTTTTTAATCTTTGTGACAGGAAAGCCC

Ensembl | nº de acceso humano

ENSG00000142208

Nº de acceso NCBI

NM_005163

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AKT1(207) , AKT1(207)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gang Shen et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 798-809 (2018-10-12)
Bromodomain-containing protein 4 (BRD4) overexpression participates in prostate cancer progression by enhancing the transcriptional activity and expression of several key oncogenes. AZD5153 is a novel BRD4 inhibitor. Prostate cancer cells were treated with AZD5153. Cell survival was tested by MTT
Sisi Chen et al.
Experimental hematology, 45, 74-84 (2016-10-25)
Although practiced clinically for more than 40 years, the use of hematopoietic stem cell (HSC) transplantation remains limited by the inability to expand functional HSCs ex vivo. To determine the role of phosphoinositide 3-kinase (PI3K)/AKT signaling in human hematopoietic stem and progenitor
Guoxing Xu et al.
Scientific reports, 7, 42411-42411 (2017-02-17)
Recent studies have shown that some members of the tripartite motif-containing protein (TRIM) family serve as important regulators of tumorigenesis. However, the biological role of TRIM14 in osteosarcoma remains to be established. In this study, we showed that TRIM14 is
Farrukh Aqil et al.
Cancer letters, 449, 186-195 (2019-02-17)
Gene-silencing with targeted siRNAs has great potential as a therapeutic approach for various diseases including cancer. However, intracellular delivery of siRNA is challenging. We used bovine milk exosomes as a novel system for siRNA delivery. First, we demonstrated that exosomes
Alexander Kretschmer et al.
Scientific reports, 9(1), 7826-7826 (2019-05-28)
Tunneling nanotubes (TNTs) are actin-based membranous structures bridging distant cells for intercellular communication. We define roles for TNTs in stress adaptation and treatment resistance in prostate cancer (PCa). Androgen receptor (AR) blockade and metabolic stress induce TNTs, but not in
Ver todos los artículos relacionados

Artículos

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico