Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU077471

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGA

Ensembl | nº de acceso humano

ENSG00000105221

Nº de acceso NCBI

NM_001626

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AKT2(208) , AKT2(208)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wanmu Xie et al.
Journal of thrombosis and thrombolysis, 50(1), 98-111 (2020-05-03)
Venous thromboembolism (VTE) carries a high risk of morbidity and mortality. Understanding the mechanisms of venous thrombus formation and resolution is critical for improving VTE management. AKT2 kinase is essential for platelet activation and arterial thrombosis. In this study, we
Mohammad Imran Khan et al.
Molecular cancer therapeutics, 18(2), 356-363 (2018-11-18)
Hyperactivated AKT kinase due to loss of its negative regulator PTEN influences many aspects of cancer biology, including chromatin. AKT primarily regulates acetyl-CoA production and phosphorylates many histone-modulating enzymes, resulting in their activation or inhibition. Therefore, understanding the therapeutic impact
Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Yang Sun et al.
PloS one, 10(4), e0119783-e0119783 (2015-04-10)
Aberrant microRNA (miRNA) expression is associated with tumor development. This study aimed to elucidate the role of miR-615-5p in the development of pancreatic ductal adenocarcinoma (PDAC). Locked nucleic acid in situ hybridization (LNA-ISH) was performed to compare miR-615-5p expression in
Dineo Khabele et al.
Journal of Cancer, 5(8), 670-678 (2014-09-27)
Overexpression of the epidermal growth factor receptor (EGFR) is associated with the malignant phenotype in many cancers including ovarian cancer, which leads to increased cell proliferation and survival. In spite of emerging EGFR inhibitors as a potentially useful agent, they
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico