Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU052501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGTGGATCGCCAAATTATGCAGCACCTGAGGTCATCTCAGGAAGGCTGTATGCAGGTCCCGAGGTCGATATCTGGAGCTGTGGTGTCATCCTGTATGCCCTTCTCTGTGGCACCCTCCCTTTCGATGATGAGCACGTGCCTACGCTCTTCAAGAAGATCCGAGGGGGTGTGTTTTACATCCCAGACTATCTCAACCGTTCTGTCGCCACTCTGCTGATGCACATGCTCCAGGTGGACCCCCTGAAGCGAGCGACTATCAAAGACATACGAGAACATGAATGGTTTAAACAGGATTTGCCCAGCTACCTATTTCCTGAAGACCCCTCCTACGATGCGAATGTCATTGTCGATGAGGCTGTGAAGGAAGTCTGTGAGAAATTCGAGTGTACAGAGTCAGAAGTGATGAATAGTCTGTATAGTGGTGACCCTCAAGACCAGCTTGCAGTGGCTTAT

Ensembl | nº de acceso | ratón

ENSMUSG00000028518

Nº de acceso NCBI

NM_178143

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PRKAA2(108079) , Prkaa2(108079)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HDT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sreevidya Santha et al.
The Journal of biological chemistry, 290(36), 21865-21875 (2015-07-23)
Prostate cancer (PCa) is one of the most frequently diagnosed cancers in men with limited treatment options for the hormone-resistant forms. Development of novel therapeutic options is critically needed to target advanced forms. Here we demonstrate that combinatorial treatment with
Sravanth K Hindupur et al.
Breast cancer research : BCR, 16(4), 420-420 (2014-08-07)
Matrix detachment triggers anoikis, a form of apoptosis, in most normal epithelial cells, while acquisition of anoikis resistance is a prime requisite for solid tumor growth. Of note, recent studies have revealed that a small population of normal human mammary
Xia Cao et al.
Hypertension research : official journal of the Japanese Society of Hypertension, 37(9), 803-810 (2014-06-27)
The purpose of this study was to determine the effects of resveratrol (RSV) and the molecular mechanisms by which it regulates vascular smooth muscle contraction and blood pressure in mice. In cultured human vascular smooth muscle cells (VSMCs), we found
Teraneh Z Jhaveri et al.
Oncotarget, 6(17), 14754-14765 (2015-07-06)
AMP-activated Protein Kinase (AMPK) activity retards growth of many types of cancers. Investigating effects of AMPK activation on breast cancer cell signaling and survival, we found that breast cancer cell lines with amplification and over-expression of HER2 or EGFR are
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico