Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU029731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rb1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGGGCTGTGTTGACATCGGAGTACAGCGATATAAACTTGGAGTCCGATTGTATTACCGTGTGATGGAATCCATGCTTAAATCAGAAGAAGAACGTTTGTCCATTCAGAATTTTAGCAAACTCCTAAATGACAACATCTTTCATATGTCTTTACTGGCCTGTGCTCTTGAAGTTGTAATGGCTACGTATAGCAGAAGTACATTGCAGCATCTTGATTCTGGAACAGATTTGTCCTTCCCGTGGATTCTGAACGTACTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATTGAAAGTTTTATCAAAGTGGAAGCCAACTTGACAAGAGAAATGATAAAACATTTAGAAAGATGTGAGCATCGAATCATGGAATCCCTTGCATGGCTTTCAGATTCACCTTTATTTGATCTCATTAAGCAGTCCAAGGATGGAGAAGGACCTGATAACCTTGAACCTGCTTGTCCTC

Ensembl | nº de acceso | ratón

ENSMUSG00000022105

Nº de acceso NCBI

NM_009029

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... RB1(19645) , Rb1(19645)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi-Xiang Zhang et al.
Molecular cancer therapeutics, 13(9), 2184-2193 (2014-07-17)
Well-differentiated/dedifferentiated liposarcomas (WD/DDLPS) are among the most common subtypes of soft tissue sarcomas. Conventional systemic chemotherapy has limited efficacy and novel therapeutic strategies are needed to achieve better outcomes for patients. The cyclin-dependent kinase 4 (CDK4) gene is highly amplified
Donald J Vander Griend et al.
International journal of biological sciences, 10(6), 627-642 (2014-06-21)
In normal prostate, androgen-dependent androgen receptor (AR) signaling within prostate stromal cells induces their secretion of paracrine factors, termed "andromedins" which stimulate growth of the epithelial cells. The present studies demonstrate that androgen-dependent andromedin-driven growth stimulation is counter-balanced by androgen-induced

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico