Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU028461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdkn1b

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCGAACGCTGGCACTGTGGAGCAGACGCCCAAGAAGCCCGGCCTTCGACGCCAGACGTAAACAGCTCCGGTGGGTTAATGAGGAAGAACACAAAACTGACACCCCATCTGGGCTGCGCTCCCCGGGGGGCCTGCAGACCCCAGGACTGCTGGCAGATTAGTTGCCTGCCAGGAGGAATTACTTTCCTTGATCAAAAAAATTAACACTGGGGAAGGCTGGAATCACTTGAGGGGACTATAATGCAGTATTTGCACCCCAAGATATTTACCTTAAAGTGGAATCAGAATGAGGTTCCCAAGCAAGAACTTGCCACCAAGGCCCCAAAGGATAGGGACGGTCGTATCCTTATGAATCCCACTAAAACTTAGGCTGGGAATGACAGTTTTCCTTTCCAGTCTCAGTTCATGAGAACCCATTTCCCAGAG

Ensembl | nº de acceso | ratón

ENSMUSG00000003031

Nº de acceso NCBI

NP_034005

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CDKN1B(12576) , Cdkn1b(12576)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Abedul Haque et al.
Apoptosis : an international journal on programmed cell death, 20(7), 986-995 (2015-04-11)
Combinatorial approaches using two or more compounds are gaining increasing attention for cancer therapy. We have previously reported that the combination of the EGFR-TKI erlotinib and epigallocatechin-3-gallate (EGCG) exhibited synergistic chemopreventive effects in head and neck cancers by inducing the
Juan Qin et al.
Oncotarget, 6(9), 6944-6958 (2015-03-10)
Side population (SP) contains cancer stem-like cells (CSLCs). In this study, we characterized SP cells from nasopharyngeal carcinoma (NPC) cell lines and found that SP cells had a higher self-renewal ability in vitro and greater tumorigenicity in vivo. The AKT

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico