Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU151281

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK6 (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCCCAAATTATGATTCCTACGCCAGCTACGACGTGAACGGCAATGATTATGACCCATCTCCACGATATGATGCCAGCAATGAAAATAAACACGGCACTCGTTGTGCGGGAGAAGTTGCTGCTTCAGCAAACAATTCCTACTGCATCGTGGGCATAGCGTACAATGCCAAAATAGGAGGCATCCGCATGCTGGACGGCGATGTCACAGATGTGGTCGAGGCAAAGTCGCTGGGCATCAGACCCAACTACATCGACATTTACAGTGCCAGCTGGGGGCCGGACGACGACGGCAAGACGGTGGACGGGCCCGGCCGACTGGCTAAGCAGGCTTTCGAGTATGGCATTAAAAAGGGCCGGCAGGGCCTGGGCTCCATTTTCGTCTGGGCATCTGGGAATGGCGGGAGAGAGGGGGACTACTGCTCGTGCGATGGCTACACCAACAGCATCTACACCATCTCCGTCAGCAGCGCCACCGAGAATGGCTACAAGCCCTGGTACCTGGAAGAGTGTGCCTCCACCCTGGCCACCACCTACAGCAGTGGGGCCTTTTATGAGCGAAAAATCGTCACC

Ensembl | nº de acceso humano

ENSG00000140479

Nº de acceso NCBI

NM_002570

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PCSK6(5046) , PCSK6(5046)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiao-Feng Tian et al.
Molecular medicine reports, 14(6), 5205-5210 (2016-10-26)
Previous studies have demonstrated the overexpression of paired basic amino acid cleaving enzyme 4 (PACE4) mRNA in prostate cancer tissues. This overexpression is correlated with higher circulating protein levels in certain patients, however, the role of PACE4 in apoptosis and the
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one
Zhiyong Yao et al.
Drug design, development and therapy, 9, 5911-5923 (2015-11-26)
PACE4 is a proprotein convertase capable of processing numerous substrates involved in tumor growth, invasion, and metastasis. However, the precise role of PACE4 during prostate cancer cell apoptosis has not been reported. In the present study, human prostate cancer cell
Huiyu Jiang et al.
Molecular medicine reports, 12(5), 7681-7686 (2015-10-16)
The aim of the present study was to assess the effects of pro-protein convertase subtilisin/kexin type 6 (PCSK6), a proteinase implicated in the proteolytic activity of various precursor proteins and involved in the regulation of protein maturation, in fibroblast‑like synoviocytes

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico