Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU139421

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNNB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCACCATCCCACT

Ensembl | nº de acceso humano

ENSG00000168036

Nº de acceso NCBI

NM_001098209

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CTNNB1(1499) , CTNNB1(1499)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rob M Ewing et al.
Journal of proteome research, 17(6), 2216-2225 (2018-05-12)
The dysregulation of Wnt signaling is a frequent occurrence in many different cancers. Oncogenic mutations of CTNNB1/β-catenin, the key nuclear effector of canonical Wnt signaling, lead to the accumulation and stabilization of β-catenin protein with diverse effects in cancer cells.
Izabela Janus et al.
Acta veterinaria Hungarica, 64(1), 90-102 (2016-02-27)
Primary heart tumours affect less than 1% of dogs. Due to their rare incidence, every research showing the frequency of cardiac tumours is valuable. Routine diagnostics is often complemented with immunohistochemical analysis. This study was conducted on 110 patient records
Peng Kong et al.
Oncotarget, 8(70), 115089-115101 (2018-02-01)
Microwave ablation (MWA), a thermal ablation, is an effective treatment for breast cancer. However, residual breast cancer is still detected. The biological characteristics of residual breast cancer after thermal ablation remain unknown. To mimic insufficient MWA
Bing Z Carter et al.
Cancer research, 79(6), 1165-1177 (2019-01-25)
The apoptosis repressor with caspase recruitment domain (ARC) protein is a strong independent adverse prognostic marker in acute myeloid leukemia (AML). We previously reported that ARC regulates leukemia-microenvironment interactions through the NFκB/IL1β signaling network. Malignant cells have been reported to
Pradip De et al.
Oncotarget, 8(2), 3072-3103 (2016-12-03)
The acquisition of integrin-directed metastasis-associated (ID-MA) phenotypes by Triple-Negative Breast Cancer (TNBC) cells is caused by an upregulation of the Wnt-beta-catenin pathway (WP). We reported that WP is one of the salient genetic features of TNBC. RAC-GTPases, small G-proteins which
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico