EHU125831
MISSION® esiRNA
targeting human SMURF1
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
Productos recomendados
descripción
Powered by Eupheria Biotech
Línea del producto
MISSION®
Formulario
lyophilized powder
secuencia objetivo ADNc esiRNA
GCCTGTACTGGACCACACCTTCTGCGTGGAACACAACGCCTTCGGGCGGATCCTGCAGCATGAACTGAAACCCAATGGCAGAAATGTGCCAGTCACAGAGGAGAATAAGAAAGAATACGTCCGGTTGTATGTAAACTGGAGGTTTATGAGAGGAATCGAAGCCCAGTTCTTAGCTCTGCAGAAGGGGTTCAATGAGCTCA
Ensembl | nº de acceso humano
Nº de acceso NCBI
Condiciones de envío
ambient
temp. de almacenamiento
−20°C
Información sobre el gen
human ... SMURF1(57154) , SMURF1(57154)
Categorías relacionadas
Descripción general
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de clase de almacenamiento
10 - Combustible liquids
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
K Koefoed et al.
Scientific reports, 8(1), 9542-9542 (2018-06-24)
Smad ubiquitin regulatory factor 1 (SMURF1) is a HECT-type E3 ubiquitin ligase that plays a critical role in vertebrate development by regulating planar cell polarity (PCP) signaling and convergent extension (CE). Here we show that SMURF1 is involved in mammalian
Youmao Tao et al.
Oncology reports, 38(3), 1806-1814 (2017-07-22)
Smad ubiquitin regulatory factor 1 (SMURF1), a well-known E3 ubiquitin ligase, targets substrate proteins for ubiquitination and proteasomal degradation. Accumulating studies have shown that SMURF1 acts as an oncogenic factor in human malignancies. However, the clinical significance of SMURF1 and its
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico